\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222221868:

Variant ID: vg1222221868 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22221868
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAGAAGCAGCCGATAGAGCTAAATTGATATGCTAAGACTAGATTAACAGAGACATATGATAAATAGGTAGGCAAGTATATCATCCAAACCAGAGCAATC[T/C]
AAGAGGTCGAATGTCCTGATGCAGCCTTGAACGACGCCGACGTAGACGATATAATTGCCTGGGCCGACGGAACATTGGACTTACCCCTTAGCCGGAGATC

Reverse complement sequence

GATCTCCGGCTAAGGGGTAAGTCCAATGTTCCGTCGGCCCAGGCAATTATATCGTCTACGTCGGCGTCGTTCAAGGCTGCATCAGGACATTCGACCTCTT[A/G]
GATTGCTCTGGTTTGGATGATATACTTGCCTACCTATTTATCATATGTCTCTGTTAATCTAGTCTTAGCATATCAATTTAGCTCTATCGGCTGCTTCTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 16.90% 3.40% 1.50% 78.14% NA
All Indica  2759 3.50% 2.20% 1.96% 92.35% NA
All Japonica  1512 44.80% 0.40% 0.73% 54.10% NA
Aus  269 0.70% 32.30% 1.49% 65.43% NA
Indica I  595 4.50% 0.20% 1.34% 93.95% NA
Indica II  465 5.20% 0.00% 2.80% 92.04% NA
Indica III  913 1.60% 4.50% 0.99% 92.88% NA
Indica Intermediate  786 3.80% 2.40% 3.05% 90.71% NA
Temperate Japonica  767 73.30% 0.30% 0.65% 25.81% NA
Tropical Japonica  504 12.10% 0.40% 0.99% 86.51% NA
Japonica Intermediate  241 22.40% 0.80% 0.41% 76.35% NA
VI/Aromatic  96 0.00% 8.30% 0.00% 91.67% NA
Intermediate  90 26.70% 1.10% 2.22% 70.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222221868 T -> C LOC_Os12g36270.1 downstream_gene_variant ; 2890.0bp to feature; MODIFIER silent_mutation Average:9.799; most accessible tissue: Minghui63 root, score: 21.615 N N N N
vg1222221868 T -> C LOC_Os12g36300.1 downstream_gene_variant ; 4342.0bp to feature; MODIFIER silent_mutation Average:9.799; most accessible tissue: Minghui63 root, score: 21.615 N N N N
vg1222221868 T -> C LOC_Os12g36270-LOC_Os12g36300 intergenic_region ; MODIFIER silent_mutation Average:9.799; most accessible tissue: Minghui63 root, score: 21.615 N N N N
vg1222221868 T -> DEL N N silent_mutation Average:9.799; most accessible tissue: Minghui63 root, score: 21.615 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222221868 1.70E-06 1.70E-06 mr1812 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251