\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222204534:

Variant ID: vg1222204534 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22204534
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTCACGTGAAGCACATACCCGGCCGTACGTAACTTTTTCTGTTTGGGATAACATTATTTATTTATCCATTCCTAGCTACTCTCCCCCGTTTCACAATG[T/G]
AAGTCATTCTGGTATTTTCCACATTCATATTGATATTAATGAATCTAGATAGATAAATGCTAGAATGACTTATATTATGAAACGGAGGAAGTAGCACAGA

Reverse complement sequence

TCTGTGCTACTTCCTCCGTTTCATAATATAAGTCATTCTAGCATTTATCTATCTAGATTCATTAATATCAATATGAATGTGGAAAATACCAGAATGACTT[A/C]
CATTGTGAAACGGGGGAGAGTAGCTAGGAATGGATAAATAAATAATGTTATCCCAAACAGAAAAAGTTACGTACGGCCGGGTATGTGCTTCACGTGAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 16.40% 0.36% 18.62% NA
All Indica  2759 80.80% 3.90% 0.36% 14.97% NA
All Japonica  1512 49.80% 34.50% 0.33% 15.34% NA
Aus  269 8.20% 8.90% 0.37% 82.53% NA
Indica I  595 88.70% 8.40% 0.00% 2.86% NA
Indica II  465 78.10% 1.70% 0.43% 19.78% NA
Indica III  913 76.00% 2.80% 0.44% 20.70% NA
Indica Intermediate  786 81.80% 3.10% 0.51% 14.63% NA
Temperate Japonica  767 80.40% 7.70% 0.52% 11.34% NA
Tropical Japonica  504 15.10% 64.30% 0.00% 20.63% NA
Japonica Intermediate  241 24.90% 57.70% 0.41% 17.01% NA
VI/Aromatic  96 4.20% 89.60% 0.00% 6.25% NA
Intermediate  90 51.10% 40.00% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222204534 T -> DEL N N silent_mutation Average:65.498; most accessible tissue: Minghui63 root, score: 91.553 N N N N
vg1222204534 T -> G LOC_Os12g36240.1 upstream_gene_variant ; 1094.0bp to feature; MODIFIER silent_mutation Average:65.498; most accessible tissue: Minghui63 root, score: 91.553 N N N N
vg1222204534 T -> G LOC_Os12g36230.1 downstream_gene_variant ; 3015.0bp to feature; MODIFIER silent_mutation Average:65.498; most accessible tissue: Minghui63 root, score: 91.553 N N N N
vg1222204534 T -> G LOC_Os12g36250.1 downstream_gene_variant ; 1746.0bp to feature; MODIFIER silent_mutation Average:65.498; most accessible tissue: Minghui63 root, score: 91.553 N N N N
vg1222204534 T -> G LOC_Os12g36260.1 downstream_gene_variant ; 3293.0bp to feature; MODIFIER silent_mutation Average:65.498; most accessible tissue: Minghui63 root, score: 91.553 N N N N
vg1222204534 T -> G LOC_Os12g36240-LOC_Os12g36250 intergenic_region ; MODIFIER silent_mutation Average:65.498; most accessible tissue: Minghui63 root, score: 91.553 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1222204534 T G 0.0 -0.01 -0.01 -0.02 -0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222204534 3.95E-06 NA mr1583_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251