\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222202905:

Variant ID: vg1222202905 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22202905
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGAAGGCAGGCAGATGAGGCTAGTAGCTAGCTCTAGCCGATGGTGGGGGTGCCGGCGACGGTGTCGACGAAGATGCGGACGCGGTTGGGGCGGAAGTC[C/G]
ATGGTCACCGGCGTCCCCACCGGAACCACGACGATGTCGGCGTCGGGCATGTCCTTGAGGATCACCTTCTTCGCCTCCTCCGCCCGCAGCCCCACCACCT

Reverse complement sequence

AGGTGGTGGGGCTGCGGGCGGAGGAGGCGAAGAAGGTGATCCTCAAGGACATGCCCGACGCCGACATCGTCGTGGTTCCGGTGGGGACGCCGGTGACCAT[G/C]
GACTTCCGCCCCAACCGCGTCCGCATCTTCGTCGACACCGTCGCCGGCACCCCCACCATCGGCTAGAGCTAGCTACTAGCCTCATCTGCCTGCCTTCAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 1.50% 0.40% 14.24% NA
All Indica  2759 96.30% 0.00% 0.11% 3.55% NA
All Japonica  1512 64.30% 4.50% 0.86% 30.36% NA
Aus  269 91.80% 0.00% 0.00% 8.18% NA
Indica I  595 91.80% 0.00% 0.17% 8.07% NA
Indica II  465 98.50% 0.00% 0.22% 1.29% NA
Indica III  913 97.20% 0.00% 0.00% 2.85% NA
Indica Intermediate  786 97.60% 0.00% 0.13% 2.29% NA
Temperate Japonica  767 85.30% 7.40% 0.52% 6.78% NA
Tropical Japonica  504 41.50% 0.80% 1.59% 56.15% NA
Japonica Intermediate  241 45.20% 2.90% 0.41% 51.45% NA
VI/Aromatic  96 21.90% 1.00% 3.12% 73.96% NA
Intermediate  90 73.30% 1.10% 0.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222202905 C -> DEL LOC_Os12g36240.1 N frameshift_variant Average:85.313; most accessible tissue: Zhenshan97 root, score: 96.46 N N N N
vg1222202905 C -> G LOC_Os12g36240.1 missense_variant ; p.Met64Ile; MODERATE nonsynonymous_codon ; M64L Average:85.313; most accessible tissue: Zhenshan97 root, score: 96.46 benign -0.417 TOLERATED 0.48

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1222202905 C G 0.02 -0.01 -0.02 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222202905 NA 1.69E-11 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1222202905 8.29E-07 4.85E-06 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222202905 5.46E-06 NA mr1332 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222202905 5.55E-06 NA mr1614 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251