\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222195768:

Variant ID: vg1222195768 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22195768
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTCCTGACGTGGACTGCAGCAGGTGTCGGCTCTGTCAGGCCGCGGCACGCAACTGCATTGGGCAGCGGTGGTGGCTGCAGTGGGAGGACCCACTATTA[T/G]
GAATACAATTTTCTTAGACGGGGTGCATTTATTTTTCCAGGTGAAGATCATTTTCACGTATGGCCACCTAGGAAGATTATTTTAATAATAGGTAAAGGTT

Reverse complement sequence

AACCTTTACCTATTATTAAAATAATCTTCCTAGGTGGCCATACGTGAAAATGATCTTCACCTGGAAAAATAAATGCACCCCGTCTAAGAAAATTGTATTC[A/C]
TAATAGTGGGTCCTCCCACTGCAGCCACCACCGCTGCCCAATGCAGTTGCGTGCCGCGGCCTGACAGAGCCGACACCTGCTGCAGTCCACGTCAGGAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 17.00% 0.70% 21.71% NA
All Indica  2759 71.10% 1.60% 0.43% 26.86% NA
All Japonica  1512 44.80% 48.90% 0.79% 5.56% NA
Aus  269 26.00% 0.00% 3.35% 70.63% NA
Indica I  595 81.00% 2.00% 0.00% 16.97% NA
Indica II  465 81.30% 3.20% 0.65% 14.84% NA
Indica III  913 58.90% 0.80% 0.77% 39.54% NA
Indica Intermediate  786 71.60% 1.40% 0.25% 26.72% NA
Temperate Japonica  767 11.90% 80.70% 0.78% 6.65% NA
Tropical Japonica  504 86.10% 12.50% 0.40% 0.99% NA
Japonica Intermediate  241 63.10% 23.70% 1.66% 11.62% NA
VI/Aromatic  96 92.70% 1.00% 0.00% 6.25% NA
Intermediate  90 74.40% 20.00% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222195768 T -> DEL N N silent_mutation Average:74.149; most accessible tissue: Minghui63 root, score: 86.253 N N N N
vg1222195768 T -> G LOC_Os12g36210.1 upstream_gene_variant ; 1886.0bp to feature; MODIFIER silent_mutation Average:74.149; most accessible tissue: Minghui63 root, score: 86.253 N N N N
vg1222195768 T -> G LOC_Os12g36220.1 downstream_gene_variant ; 2150.0bp to feature; MODIFIER silent_mutation Average:74.149; most accessible tissue: Minghui63 root, score: 86.253 N N N N
vg1222195768 T -> G LOC_Os12g36210-LOC_Os12g36220 intergenic_region ; MODIFIER silent_mutation Average:74.149; most accessible tissue: Minghui63 root, score: 86.253 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1222195768 T G 0.01 0.02 0.01 0.01 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222195768 NA 2.43E-15 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1222195768 4.87E-06 2.55E-08 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 4.64E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 3.59E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 4.52E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 4.55E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 1.25E-20 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 3.87E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 2.63E-09 2.00E-12 mr1334_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 5.56E-06 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 1.85E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 7.13E-07 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 5.63E-06 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 9.48E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 5.51E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 1.37E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 2.50E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 8.32E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 2.95E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 3.89E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 2.91E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 1.25E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222195768 NA 4.55E-15 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251