\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222089377:

Variant ID: vg1222089377 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22089377
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTCCACTCGCTCATAATCACTATGCACAAATGCATGCAAGCGTCCATCTAAAAATGGCCAAAGCCCACCACTTGCCGGTCCGCCATGAATCTATCAAA[G/T]
CAAGATTTAGCTGCTTCATAAACTTAATAATACCCAATTACCCATCCATTCGATCATCTCCGGTTAATTTCATGGACACAACGACGACCATGGCGCCTCT

Reverse complement sequence

AGAGGCGCCATGGTCGTCGTTGTGTCCATGAAATTAACCGGAGATGATCGAATGGATGGGTAATTGGGTATTATTAAGTTTATGAAGCAGCTAAATCTTG[C/A]
TTTGATAGATTCATGGCGGACCGGCAAGTGGTGGGCTTTGGCCATTTTTAGATGGACGCTTGCATGCATTTGTGCATAGTGATTATGAGCGAGTGGAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 8.00% 0.00% 0.00% NA
All Indica  2759 93.00% 7.00% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 35.70% 64.30% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 92.50% 7.50% 0.00% 0.00% NA
Indica III  913 88.90% 11.10% 0.00% 0.00% NA
Indica Intermediate  786 94.10% 5.90% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222089377 G -> T LOC_Os12g36040.1 upstream_gene_variant ; 57.0bp to feature; MODIFIER silent_mutation Average:56.987; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg1222089377 G -> T LOC_Os12g36030-LOC_Os12g36040 intergenic_region ; MODIFIER silent_mutation Average:56.987; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222089377 NA 5.15E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222089377 8.12E-07 5.27E-07 mr1585 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222089377 NA 8.57E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222089377 NA 6.14E-19 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222089377 NA 3.42E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222089377 NA 6.44E-10 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222089377 NA 1.11E-10 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251