\
| Variant ID: vg1221931538 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21931538 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 99. )
AAGTTATATAGAAAAATAACCAAAATAAAAGCTATAGATCTTGATGAGTTATACAACTTTGTTGTTGATGATTTTTTTAGTTGAAATCATTTAGTATTTG[A/G]
AAATGTTTTTTCTGAAGTTGTCATATTTTTAAATTCAAATTCAAACCGTTCAAAAAAAAGTTTATATTGAAAAATGACCAAAATAAAAGTTTTAACACTT
AAGTGTTAAAACTTTTATTTTGGTCATTTTTCAATATAAACTTTTTTTTGAACGGTTTGAATTTGAATTTAAAAATATGACAACTTCAGAAAAAACATTT[T/C]
CAAATACTAAATGATTTCAACTAAAAAAATCATCAACAACAAAGTTGTATAACTCATCAAGATCTATAGCTTTTATTTTGGTTATTTTTCTATATAACTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 28.40% | 4.04% | 12.82% | NA |
| All Indica | 2759 | 31.20% | 47.80% | 6.56% | 14.39% | NA |
| All Japonica | 1512 | 90.90% | 0.30% | 0.26% | 8.60% | NA |
| Aus | 269 | 75.50% | 2.20% | 1.49% | 20.82% | NA |
| Indica I | 595 | 9.90% | 76.50% | 9.08% | 4.54% | NA |
| Indica II | 465 | 60.90% | 15.30% | 8.39% | 15.48% | NA |
| Indica III | 913 | 29.00% | 45.00% | 4.93% | 21.03% | NA |
| Indica Intermediate | 786 | 32.30% | 48.70% | 5.47% | 13.49% | NA |
| Temperate Japonica | 767 | 96.60% | 0.00% | 0.26% | 3.13% | NA |
| Tropical Japonica | 504 | 79.00% | 0.60% | 0.40% | 20.04% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.40% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 82.30% | 1.00% | 0.00% | 16.67% | NA |
| Intermediate | 90 | 76.70% | 13.30% | 2.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221931538 | A -> DEL | N | N | silent_mutation | Average:13.722; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg1221931538 | A -> G | LOC_Os12g35920-LOC_Os12g35930 | intergenic_region ; MODIFIER | silent_mutation | Average:13.722; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221931538 | NA | 2.81E-09 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221931538 | NA | 1.92E-07 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221931538 | NA | 2.60E-19 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221931538 | NA | 9.68E-07 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221931538 | NA | 1.14E-07 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221931538 | NA | 5.77E-11 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221931538 | NA | 1.53E-44 | mr1598_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221931538 | NA | 1.32E-13 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221931538 | NA | 4.32E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |