\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221931538:

Variant ID: vg1221931538 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21931538
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTATATAGAAAAATAACCAAAATAAAAGCTATAGATCTTGATGAGTTATACAACTTTGTTGTTGATGATTTTTTTAGTTGAAATCATTTAGTATTTG[A/G]
AAATGTTTTTTCTGAAGTTGTCATATTTTTAAATTCAAATTCAAACCGTTCAAAAAAAAGTTTATATTGAAAAATGACCAAAATAAAAGTTTTAACACTT

Reverse complement sequence

AAGTGTTAAAACTTTTATTTTGGTCATTTTTCAATATAAACTTTTTTTTGAACGGTTTGAATTTGAATTTAAAAATATGACAACTTCAGAAAAAACATTT[T/C]
CAAATACTAAATGATTTCAACTAAAAAAATCATCAACAACAAAGTTGTATAACTCATCAAGATCTATAGCTTTTATTTTGGTTATTTTTCTATATAACTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 28.40% 4.04% 12.82% NA
All Indica  2759 31.20% 47.80% 6.56% 14.39% NA
All Japonica  1512 90.90% 0.30% 0.26% 8.60% NA
Aus  269 75.50% 2.20% 1.49% 20.82% NA
Indica I  595 9.90% 76.50% 9.08% 4.54% NA
Indica II  465 60.90% 15.30% 8.39% 15.48% NA
Indica III  913 29.00% 45.00% 4.93% 21.03% NA
Indica Intermediate  786 32.30% 48.70% 5.47% 13.49% NA
Temperate Japonica  767 96.60% 0.00% 0.26% 3.13% NA
Tropical Japonica  504 79.00% 0.60% 0.40% 20.04% NA
Japonica Intermediate  241 97.50% 0.40% 0.00% 2.07% NA
VI/Aromatic  96 82.30% 1.00% 0.00% 16.67% NA
Intermediate  90 76.70% 13.30% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221931538 A -> DEL N N silent_mutation Average:13.722; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1221931538 A -> G LOC_Os12g35920-LOC_Os12g35930 intergenic_region ; MODIFIER silent_mutation Average:13.722; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221931538 NA 2.81E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538 NA 1.92E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538 NA 2.60E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538 NA 9.68E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538 NA 1.14E-07 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538 NA 5.77E-11 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538 NA 1.53E-44 mr1598_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538 NA 1.32E-13 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538 NA 4.32E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251