Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221892295:

Variant ID: vg1221892295 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21892295
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.07, T: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCTGGCATGACTAAAAGCTACTCCCTCCATCCGAGAATATATATAAGAAGTTTTAGAGTTTAACATGGTTATTAAGAAAGTAGATAAAAGTGAATGTT[A/G,T]
GTGAGTTGTGACTGAATGAGTAGTGGAGGTAGGTGGGAAAAATGAATAGTGGAGGATCGTGATTGGTTGGGAAAAAAATATTGATGGAGAAATTGTTATA

Reverse complement sequence

TATAACAATTTCTCCATCAATATTTTTTTCCCAACCAATCACGATCCTCCACTATTCATTTTTCCCACCTACCTCCACTACTCATTCAGTCACAACTCAC[T/C,A]
AACATTCACTTTTATCTACTTTCTTAATAACCATGTTAAACTCTAAAACTTCTTATATATATTCTCGGATGGAGGGAGTAGCTTTTAGTCATGCCAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.90%	46.40%	0.06%	0.00%	T: 0.61%
All Indica	2759	81.80%	17.10%	0.11%	0.00%	T: 0.98%
All Japonica	1512	0.80%	99.10%	0.00%	0.00%	T: 0.13%
Aus	269	61.30%	38.70%	0.00%	0.00%	NA
Indica I	595	69.90%	29.70%	0.34%	0.00%	NA
Indica II	465	92.30%	6.00%	0.00%	0.00%	T: 1.72%
Indica III	913	83.40%	15.70%	0.00%	0.00%	T: 0.99%
Indica Intermediate	786	83.00%	15.60%	0.13%	0.00%	T: 1.27%
Temperate Japonica	767	0.90%	98.80%	0.00%	0.00%	T: 0.26%
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	43.80%	56.20%	0.00%	0.00%	NA
Intermediate	90	27.80%	72.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221892295	A -> G	LOC_Os12g35920.1	upstream_gene_variant ; 1809.0bp to feature; MODIFIER	silent_mutation	Average:26.853; most accessible tissue: Callus, score: 58.459	N	N	N	N
vg1221892295	A -> G	LOC_Os12g35920-LOC_Os12g35930	intergenic_region ; MODIFIER	silent_mutation	Average:26.853; most accessible tissue: Callus, score: 58.459	N	N	N	N
vg1221892295	A -> T	LOC_Os12g35920.1	upstream_gene_variant ; 1809.0bp to feature; MODIFIER	silent_mutation	Average:26.853; most accessible tissue: Callus, score: 58.459	N	N	N	N
vg1221892295	A -> T	LOC_Os12g35920-LOC_Os12g35930	intergenic_region ; MODIFIER	silent_mutation	Average:26.853; most accessible tissue: Callus, score: 58.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221892295	NA	9.67E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	2.82E-06	mr1030	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	3.55E-13	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	1.58E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	2.57E-10	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	8.14E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	1.05E-09	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	1.95E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	1.94E-11	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	1.28E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	2.27E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	1.58E-08	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	8.78E-21	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	2.15E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	1.16E-12	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	4.71E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	9.53E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	3.83E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295	NA	3.53E-13	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251