\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221892295:

Variant ID: vg1221892295 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21892295
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.07, T: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTGGCATGACTAAAAGCTACTCCCTCCATCCGAGAATATATATAAGAAGTTTTAGAGTTTAACATGGTTATTAAGAAAGTAGATAAAAGTGAATGTT[A/G,T]
GTGAGTTGTGACTGAATGAGTAGTGGAGGTAGGTGGGAAAAATGAATAGTGGAGGATCGTGATTGGTTGGGAAAAAAATATTGATGGAGAAATTGTTATA

Reverse complement sequence

TATAACAATTTCTCCATCAATATTTTTTTCCCAACCAATCACGATCCTCCACTATTCATTTTTCCCACCTACCTCCACTACTCATTCAGTCACAACTCAC[T/C,A]
AACATTCACTTTTATCTACTTTCTTAATAACCATGTTAAACTCTAAAACTTCTTATATATATTCTCGGATGGAGGGAGTAGCTTTTAGTCATGCCAGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 46.40% 0.06% 0.00% T: 0.61%
All Indica  2759 81.80% 17.10% 0.11% 0.00% T: 0.98%
All Japonica  1512 0.80% 99.10% 0.00% 0.00% T: 0.13%
Aus  269 61.30% 38.70% 0.00% 0.00% NA
Indica I  595 69.90% 29.70% 0.34% 0.00% NA
Indica II  465 92.30% 6.00% 0.00% 0.00% T: 1.72%
Indica III  913 83.40% 15.70% 0.00% 0.00% T: 0.99%
Indica Intermediate  786 83.00% 15.60% 0.13% 0.00% T: 1.27%
Temperate Japonica  767 0.90% 98.80% 0.00% 0.00% T: 0.26%
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 27.80% 72.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221892295 A -> G LOC_Os12g35920.1 upstream_gene_variant ; 1809.0bp to feature; MODIFIER silent_mutation Average:26.853; most accessible tissue: Callus, score: 58.459 N N N N
vg1221892295 A -> G LOC_Os12g35920-LOC_Os12g35930 intergenic_region ; MODIFIER silent_mutation Average:26.853; most accessible tissue: Callus, score: 58.459 N N N N
vg1221892295 A -> T LOC_Os12g35920.1 upstream_gene_variant ; 1809.0bp to feature; MODIFIER silent_mutation Average:26.853; most accessible tissue: Callus, score: 58.459 N N N N
vg1221892295 A -> T LOC_Os12g35920-LOC_Os12g35930 intergenic_region ; MODIFIER silent_mutation Average:26.853; most accessible tissue: Callus, score: 58.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221892295 NA 9.67E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 2.82E-06 mr1030 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 3.55E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 1.58E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 2.57E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 8.14E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 1.05E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 1.95E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 1.94E-11 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 1.28E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 2.27E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 1.58E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 8.78E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 2.15E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 1.16E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 4.71E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 9.53E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 3.83E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221892295 NA 3.53E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251