\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221859917:

Variant ID: vg1221859917 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21859917
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTCACTTTATACAAAATTGAAAACACATGAGATGAATGTTCTTTCTCGCAAAGTTGATTCTAAATCGAGTGCTTTAGTTTCTTCTTCTTCCTCTTTTGAT[A/G]
TTGATGCCTCTTCATCTAAGTCGTCTTTTCTTGCTGTTTTTAATGCCACAACCGATGATCAACTCGAACAAATCGAGGAGGAGGATTTGGCTTTGGTTGC

Reverse complement sequence

GCAACCAAAGCCAAATCCTCCTCCTCGATTTGTTCGAGTTGATCATCGGTTGTGGCATTAAAAACAGCAAGAAAAGACGACTTAGATGAAGAGGCATCAA[T/C]
ATCAAAAGAGGAAGAAGAAGAAACTAAAGCACTCGATTTAGAATCAACTTTGCGAGAAAGAACATTCATCTCATGTGTTTTCAATTTTGTATAAAGTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.70% 38.20% 6.31% 9.78% NA
All Indica  2759 66.10% 7.70% 9.68% 16.46% NA
All Japonica  1512 4.80% 94.70% 0.33% 0.13% NA
Aus  269 84.80% 14.90% 0.37% 0.00% NA
Indica I  595 81.20% 15.00% 3.36% 0.50% NA
Indica II  465 24.30% 6.20% 27.74% 41.72% NA
Indica III  913 77.40% 3.80% 6.13% 12.60% NA
Indica Intermediate  786 66.40% 7.60% 7.89% 18.07% NA
Temperate Japonica  767 3.30% 96.20% 0.52% 0.00% NA
Tropical Japonica  504 8.30% 91.30% 0.20% 0.20% NA
Japonica Intermediate  241 2.50% 97.10% 0.00% 0.41% NA
VI/Aromatic  96 17.70% 61.50% 19.79% 1.04% NA
Intermediate  90 18.90% 68.90% 6.67% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221859917 A -> DEL N N silent_mutation Average:11.149; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1221859917 A -> G LOC_Os12g35870.1 upstream_gene_variant ; 2529.0bp to feature; MODIFIER silent_mutation Average:11.149; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1221859917 A -> G LOC_Os12g35880.1 intron_variant ; MODIFIER silent_mutation Average:11.149; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221859917 2.86E-06 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221859917 NA 4.86E-51 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221859917 NA 2.17E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221859917 1.33E-06 1.32E-06 mr1487_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221859917 NA 6.30E-17 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221859917 NA 9.97E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251