\
| Variant ID: vg1221859917 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21859917 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 82. )
TTCACTTTATACAAAATTGAAAACACATGAGATGAATGTTCTTTCTCGCAAAGTTGATTCTAAATCGAGTGCTTTAGTTTCTTCTTCTTCCTCTTTTGAT[A/G]
TTGATGCCTCTTCATCTAAGTCGTCTTTTCTTGCTGTTTTTAATGCCACAACCGATGATCAACTCGAACAAATCGAGGAGGAGGATTTGGCTTTGGTTGC
GCAACCAAAGCCAAATCCTCCTCCTCGATTTGTTCGAGTTGATCATCGGTTGTGGCATTAAAAACAGCAAGAAAAGACGACTTAGATGAAGAGGCATCAA[T/C]
ATCAAAAGAGGAAGAAGAAGAAACTAAAGCACTCGATTTAGAATCAACTTTGCGAGAAAGAACATTCATCTCATGTGTTTTCAATTTTGTATAAAGTGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.70% | 38.20% | 6.31% | 9.78% | NA |
| All Indica | 2759 | 66.10% | 7.70% | 9.68% | 16.46% | NA |
| All Japonica | 1512 | 4.80% | 94.70% | 0.33% | 0.13% | NA |
| Aus | 269 | 84.80% | 14.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 81.20% | 15.00% | 3.36% | 0.50% | NA |
| Indica II | 465 | 24.30% | 6.20% | 27.74% | 41.72% | NA |
| Indica III | 913 | 77.40% | 3.80% | 6.13% | 12.60% | NA |
| Indica Intermediate | 786 | 66.40% | 7.60% | 7.89% | 18.07% | NA |
| Temperate Japonica | 767 | 3.30% | 96.20% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 8.30% | 91.30% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 17.70% | 61.50% | 19.79% | 1.04% | NA |
| Intermediate | 90 | 18.90% | 68.90% | 6.67% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221859917 | A -> DEL | N | N | silent_mutation | Average:11.149; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1221859917 | A -> G | LOC_Os12g35870.1 | upstream_gene_variant ; 2529.0bp to feature; MODIFIER | silent_mutation | Average:11.149; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1221859917 | A -> G | LOC_Os12g35880.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.149; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221859917 | 2.86E-06 | NA | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221859917 | NA | 4.86E-51 | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221859917 | NA | 2.17E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221859917 | 1.33E-06 | 1.32E-06 | mr1487_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221859917 | NA | 6.30E-17 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221859917 | NA | 9.97E-06 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |