\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221851164:

Variant ID: vg1221851164 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21851164
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCTTTGGATTAGTGCCACTGCAATGGTGTTAGTGAATTAAAATACACTACATTGTGGGCTGTGGGTGCATGGTTTTGCTAGTCGTGCCCATGGCGATT[A/T]
AGGACCGGTTCGCGGGATGCCCTATAAGAACTTATCGTACTTACCACAAGCCAGCGTGGGCAATGGCTGGGCTTGTAGTGTAGCTTTCCTCTAGCCGACG

Reverse complement sequence

CGTCGGCTAGAGGAAAGCTACACTACAAGCCCAGCCATTGCCCACGCTGGCTTGTGGTAAGTACGATAAGTTCTTATAGGGCATCCCGCGAACCGGTCCT[T/A]
AATCGCCATGGGCACGACTAGCAAAACCATGCACCCACAGCCCACAATGTAGTGTATTTTAATTCACTAACACCATTGCAGTGGCACTAATCCAAAGCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.30% 16.80% 1.31% 2.54% NA
All Indica  2759 77.30% 16.30% 2.14% 4.31% NA
All Japonica  1512 95.00% 4.80% 0.13% 0.00% NA
Aus  269 17.50% 82.50% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 54.00% 33.10% 4.73% 8.17% NA
Indica III  913 76.60% 17.10% 1.20% 5.15% NA
Indica Intermediate  786 74.80% 17.60% 3.31% 4.33% NA
Temperate Japonica  767 96.90% 3.00% 0.13% 0.00% NA
Tropical Japonica  504 91.50% 8.30% 0.20% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 82.20% 15.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221851164 A -> DEL N N silent_mutation Average:33.714; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N
vg1221851164 A -> T LOC_Os12g35860.1 upstream_gene_variant ; 123.0bp to feature; MODIFIER silent_mutation Average:33.714; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N
vg1221851164 A -> T LOC_Os12g35850-LOC_Os12g35860 intergenic_region ; MODIFIER silent_mutation Average:33.714; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221851164 NA 2.35E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 3.54E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 3.35E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 8.55E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 5.60E-09 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 5.37E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 1.47E-14 mr1232_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 3.20E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 5.98E-06 mr1388_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 6.85E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 1.06E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 6.18E-07 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 2.28E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 3.03E-15 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221851164 NA 2.36E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251