\
| Variant ID: vg1221827817 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21827817 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GAGTCAGGAGAAAACAAGTGTGCAGGTGGAGCACTTGATCAGTTCAGGGCATGCACCAGAAAAAGAAGATGTTGCTATTAACCAAGATGCACCTGTTATT[C/G]
AAGATTCAGATTCTTCTATTGTTCATCAGTCTCCCAAACGTTCTATTGCAAAAGATAAGCCCAAAAGAAATATTAAACCACCTCGAAGATATATTGAAGA
TCTTCAATATATCTTCGAGGTGGTTTAATATTTCTTTTGGGCTTATCTTTTGCAATAGAACGTTTGGGAGACTGATGAACAATAGAAGAATCTGAATCTT[G/C]
AATAACAGGTGCATCTTGGTTAATAGCAACATCTTCTTTTTCTGGTGCATGCCCTGAACTGATCAAGTGCTCCACCTGCACACTTGTTTTCTCCTGACTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.30% | 11.90% | 26.81% | 32.92% | NA |
| All Indica | 2759 | 12.60% | 1.30% | 36.57% | 49.51% | NA |
| All Japonica | 1512 | 56.70% | 33.70% | 5.62% | 3.97% | NA |
| Aus | 269 | 13.80% | 0.00% | 55.02% | 31.23% | NA |
| Indica I | 595 | 14.30% | 0.50% | 22.69% | 62.52% | NA |
| Indica II | 465 | 27.70% | 2.20% | 38.06% | 32.04% | NA |
| Indica III | 913 | 5.60% | 1.40% | 44.36% | 48.63% | NA |
| Indica Intermediate | 786 | 10.40% | 1.40% | 37.15% | 51.02% | NA |
| Temperate Japonica | 767 | 34.80% | 55.80% | 6.78% | 2.61% | NA |
| Tropical Japonica | 504 | 80.40% | 9.50% | 3.57% | 6.55% | NA |
| Japonica Intermediate | 241 | 76.80% | 14.10% | 6.22% | 2.90% | NA |
| VI/Aromatic | 96 | 60.40% | 0.00% | 6.25% | 33.33% | NA |
| Intermediate | 90 | 44.40% | 18.90% | 21.11% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221827817 | C -> DEL | LOC_Os12g35810.1 | N | frameshift_variant | Average:6.835; most accessible tissue: Minghui63 flower, score: 9.27 | N | N | N | N |
| vg1221827817 | C -> G | LOC_Os12g35810.1 | missense_variant ; p.Gln505Glu; MODERATE | nonsynonymous_codon ; Q505E | Average:6.835; most accessible tissue: Minghui63 flower, score: 9.27 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221827817 | NA | 1.30E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221827817 | NA | 8.07E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221827817 | 2.94E-06 | NA | mr1486 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221827817 | NA | 5.27E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221827817 | NA | 3.23E-10 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221827817 | NA | 1.20E-09 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221827817 | NA | 3.73E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221827817 | NA | 5.89E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |