\
| Variant ID: vg1221775967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21775967 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 94. )
CTCCCTCTGCTCATCCAAATCGGCAAGGAGCCGAGCTCCTTTCCCCTCCCCTTTTTGCTTTTTCCCTCTCAGCCCGGCCGCCCGTGACCACCTCCACTGC[T/C]
GCCGCTTGGCCGCTAGCTCTGAGCACGACCGCCAGCCGAGCTCCCTTGACCACCTAAGTCGGTTTCCTCCCCCAAAACTGACTTCCCGTGCCTATAAAAC
GTTTTATAGGCACGGGAAGTCAGTTTTGGGGGAGGAAACCGACTTAGGTGGTCAAGGGAGCTCGGCTGGCGGTCGTGCTCAGAGCTAGCGGCCAAGCGGC[A/G]
GCAGTGGAGGTGGTCACGGGCGGCCGGGCTGAGAGGGAAAAAGCAAAAAGGGGAGGGGAAAGGAGCTCGGCTCCTTGCCGATTTGGATGAGCAGAGGGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.40% | 24.10% | 1.27% | 0.21% | NA |
| All Indica | 2759 | 95.10% | 2.90% | 1.67% | 0.36% | NA |
| All Japonica | 1512 | 38.60% | 61.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.00% | 1.30% | 2.69% | 0.00% | NA |
| Indica II | 465 | 90.80% | 4.90% | 2.80% | 1.51% | NA |
| Indica III | 913 | 97.30% | 2.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 3.40% | 1.78% | 0.38% | NA |
| Temperate Japonica | 767 | 28.40% | 71.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 39.90% | 59.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.50% | 31.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 33.30% | 57.30% | 9.38% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 52.20% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221775967 | T -> C | LOC_Os12g35770.1 | upstream_gene_variant ; 4332.0bp to feature; MODIFIER | silent_mutation | Average:64.163; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg1221775967 | T -> C | LOC_Os12g35760.1 | downstream_gene_variant ; 391.0bp to feature; MODIFIER | silent_mutation | Average:64.163; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg1221775967 | T -> C | LOC_Os12g35750-LOC_Os12g35760 | intergenic_region ; MODIFIER | silent_mutation | Average:64.163; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg1221775967 | T -> DEL | N | N | silent_mutation | Average:64.163; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221775967 | NA | 8.50E-07 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221775967 | NA | 3.32E-10 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221775967 | NA | 3.33E-07 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221775967 | NA | 1.34E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221775967 | NA | 8.84E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221775967 | NA | 7.86E-11 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221775967 | NA | 6.38E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221775967 | NA | 2.77E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221775967 | NA | 7.14E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221775967 | 6.17E-06 | NA | mr1907_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221775967 | 1.47E-06 | NA | mr1934_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221775967 | NA | 4.25E-10 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |