\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221775967:

Variant ID: vg1221775967 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21775967
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCCTCTGCTCATCCAAATCGGCAAGGAGCCGAGCTCCTTTCCCCTCCCCTTTTTGCTTTTTCCCTCTCAGCCCGGCCGCCCGTGACCACCTCCACTGC[T/C]
GCCGCTTGGCCGCTAGCTCTGAGCACGACCGCCAGCCGAGCTCCCTTGACCACCTAAGTCGGTTTCCTCCCCCAAAACTGACTTCCCGTGCCTATAAAAC

Reverse complement sequence

GTTTTATAGGCACGGGAAGTCAGTTTTGGGGGAGGAAACCGACTTAGGTGGTCAAGGGAGCTCGGCTGGCGGTCGTGCTCAGAGCTAGCGGCCAAGCGGC[A/G]
GCAGTGGAGGTGGTCACGGGCGGCCGGGCTGAGAGGGAAAAAGCAAAAAGGGGAGGGGAAAGGAGCTCGGCTCCTTGCCGATTTGGATGAGCAGAGGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 24.10% 1.27% 0.21% NA
All Indica  2759 95.10% 2.90% 1.67% 0.36% NA
All Japonica  1512 38.60% 61.30% 0.07% 0.00% NA
Aus  269 88.50% 11.50% 0.00% 0.00% NA
Indica I  595 96.00% 1.30% 2.69% 0.00% NA
Indica II  465 90.80% 4.90% 2.80% 1.51% NA
Indica III  913 97.30% 2.40% 0.33% 0.00% NA
Indica Intermediate  786 94.40% 3.40% 1.78% 0.38% NA
Temperate Japonica  767 28.40% 71.60% 0.00% 0.00% NA
Tropical Japonica  504 39.90% 59.90% 0.20% 0.00% NA
Japonica Intermediate  241 68.50% 31.50% 0.00% 0.00% NA
VI/Aromatic  96 33.30% 57.30% 9.38% 0.00% NA
Intermediate  90 43.30% 52.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221775967 T -> C LOC_Os12g35770.1 upstream_gene_variant ; 4332.0bp to feature; MODIFIER silent_mutation Average:64.163; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1221775967 T -> C LOC_Os12g35760.1 downstream_gene_variant ; 391.0bp to feature; MODIFIER silent_mutation Average:64.163; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1221775967 T -> C LOC_Os12g35750-LOC_Os12g35760 intergenic_region ; MODIFIER silent_mutation Average:64.163; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1221775967 T -> DEL N N silent_mutation Average:64.163; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221775967 NA 8.50E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967 NA 3.32E-10 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967 NA 3.33E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967 NA 1.34E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967 NA 8.84E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967 NA 7.86E-11 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967 NA 6.38E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967 NA 2.77E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967 NA 7.14E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967 6.17E-06 NA mr1907_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967 1.47E-06 NA mr1934_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967 NA 4.25E-10 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251