\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221736592:

Variant ID: vg1221736592 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21736592
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


ATACAACTGATATCAGTTGTGCTAGCTGTGCTTCATACTCCCTCCATACTCATAAAGTAAGTCGTTTAGAACAGCGACACAGTCTCCAAAACACAACTTT[A/G]
ACTTCTTATTTCTATAAAAATATTTATTGAAAAGTGATATATGTATACTTTTATGAAAGTATTTTTCAAGACAAATCTATACATATAATTTTTACATTTT

Reverse complement sequence

AAAATGTAAAAATTATATGTATAGATTTGTCTTGAAAAATACTTTCATAAAAGTATACATATATCACTTTTCAATAAATATTTTTATAGAAATAAGAAGT[T/C]
AAAGTTGTGTTTTGGAGACTGTGTCGCTGTTCTAAACGACTTACTTTATGAGTATGGAGGGAGTATGAAGCACAGCTAGCACAACTGATATCAGTTGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 24.20% 0.04% 0.00% NA
All Indica  2759 96.60% 3.30% 0.07% 0.00% NA
All Japonica  1512 39.20% 60.80% 0.00% 0.00% NA
Aus  269 89.20% 10.80% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 94.20% 5.60% 0.22% 0.00% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.50% 0.13% 0.00% NA
Temperate Japonica  767 28.80% 71.20% 0.00% 0.00% NA
Tropical Japonica  504 40.70% 59.30% 0.00% 0.00% NA
Japonica Intermediate  241 68.90% 31.10% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 47.80% 52.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221736592 A -> G LOC_Os12g35720.1 downstream_gene_variant ; 1316.0bp to feature; MODIFIER silent_mutation Average:40.781; most accessible tissue: Zhenshan97 flower, score: 66.841 N N N N
vg1221736592 A -> G LOC_Os12g35710-LOC_Os12g35720 intergenic_region ; MODIFIER silent_mutation Average:40.781; most accessible tissue: Zhenshan97 flower, score: 66.841 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221736592 4.50E-06 4.95E-12 mr1050_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 1.25E-06 NA mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 7.79E-07 NA mr1102_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 1.12E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 6.15E-06 NA mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 3.13E-06 NA mr1187_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 9.22E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 7.62E-06 1.89E-06 mr1209_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 2.05E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 9.92E-06 7.86E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 7.75E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 9.51E-06 2.51E-09 mr1272_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 8.45E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 2.47E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 2.73E-06 NA mr1347_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 1.93E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 2.36E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 2.47E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 6.55E-06 6.52E-06 mr1413_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 7.52E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 4.17E-06 2.64E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 1.10E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 2.78E-06 2.85E-10 mr1765_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 2.17E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 1.07E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 1.93E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 7.91E-06 NA mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221736592 NA 3.83E-11 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251