\
| Variant ID: vg1221718597 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21718597 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 116. )
CTCCAAACCAAGCACGCTTAACGAGATTGGCTTCCGGAAAAGTAGTTGTAACATGTTGGTATGAGTATTCTATTAATCCTATTAAATCCTAAACCAGGAT[G/A]
TCAAATTGGGGTTATTAAATGATTTCAAATGGAAAAGTCACCAAAACCAAAGTTGTAGAACTCATCGAGGTGCAAAATTTTTATTTTGGTCATTTCTCCA
TGGAGAAATGACCAAAATAAAAATTTTGCACCTCGATGAGTTCTACAACTTTGGTTTTGGTGACTTTTCCATTTGAAATCATTTAATAACCCCAATTTGA[C/T]
ATCCTGGTTTAGGATTTAATAGGATTAATAGAATACTCATACCAACATGTTACAACTACTTTTCCGGAAGCCAATCTCGTTAAGCGTGCTTGGTTTGGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.70% | 19.80% | 1.52% | 0.00% | NA |
| All Indica | 2759 | 67.60% | 29.80% | 2.57% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.70% | 28.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 41.00% | 50.60% | 8.40% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 61.60% | 38.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 76.30% | 21.40% | 2.29% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221718597 | G -> A | LOC_Os12g35710.1 | upstream_gene_variant ; 4738.0bp to feature; MODIFIER | silent_mutation | Average:35.199; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| vg1221718597 | G -> A | LOC_Os12g35710-LOC_Os12g35720 | intergenic_region ; MODIFIER | silent_mutation | Average:35.199; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221718597 | NA | 2.91E-06 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221718597 | 1.30E-06 | NA | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221718597 | 2.62E-07 | NA | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221718597 | 1.70E-06 | NA | mr1141_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221718597 | NA | 5.40E-06 | mr1236_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221718597 | 1.87E-07 | NA | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221718597 | 2.37E-06 | NA | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221718597 | NA | 5.06E-07 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221718597 | NA | 4.05E-07 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221718597 | NA | 2.27E-09 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221718597 | NA | 7.72E-07 | mr1641_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221718597 | NA | 3.84E-06 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221718597 | NA | 3.23E-07 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |