\
| Variant ID: vg1221714747 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21714747 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 241. )
ACAGTACAACTAACACTGTATAAATTTAGATGACGCCTCCTCGTGCTCTCTCAAACACAACACAACACATGTTCTCAAATCTATCGTCTTTGACAACTTA[C/T]
GATGTAGGAGTGATAGAAACTAGGAATAGAAAAACAAGCCTTCTCGACCACCCTGCCTTTATTAAGATAATAATGCTTACAAGGTAGTCTCTCCGTTCCA
TGGAACGGAGAGACTACCTTGTAAGCATTATTATCTTAATAAAGGCAGGGTGGTCGAGAAGGCTTGTTTTTCTATTCCTAGTTTCTATCACTCCTACATC[G/A]
TAAGTTGTCAAAGACGATAGATTTGAGAACATGTGTTGTGTTGTGTTTGAGAGAGCACGAGGAGGCGTCATCTAAATTTATACAGTGTTAGTTGTACTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.00% | 24.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 96.80% | 3.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 39.20% | 60.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 88.50% | 11.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 4.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 29.30% | 70.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 40.10% | 59.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 43.80% | 56.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 48.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221714747 | C -> T | LOC_Os12g35710.1 | upstream_gene_variant ; 888.0bp to feature; MODIFIER | silent_mutation | Average:39.359; most accessible tissue: Callus, score: 76.03 | N | N | N | N |
| vg1221714747 | C -> T | LOC_Os12g35710-LOC_Os12g35720 | intergenic_region ; MODIFIER | silent_mutation | Average:39.359; most accessible tissue: Callus, score: 76.03 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221714747 | NA | 3.84E-10 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221714747 | NA | 1.16E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221714747 | NA | 9.32E-07 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221714747 | NA | 2.76E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221714747 | NA | 1.46E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221714747 | NA | 9.09E-15 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221714747 | NA | 2.00E-07 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221714747 | NA | 9.35E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221714747 | 4.96E-06 | NA | mr1907_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221714747 | NA | 1.48E-07 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221714747 | NA | 2.27E-07 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221714747 | 3.82E-06 | NA | mr1934_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221714747 | NA | 1.07E-09 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |