Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221698940:

Variant ID: vg1221698940 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21698940
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGTTGCTAGCAATAAAGTAGGAAATTCACGTACTTACCACAGAGGGAGGAGTATATATATAGAGAGAGGAGATTTCTTTTTTATTAGAAACAGATCCTT[G/A]
ACATATATCTAATTGTTAGAAATAATAGATTCATCGAGATATATCTAATTGTTCGAAATAATAGATTCATCGGTTTATAAGTTATAACTGATGGTCATAT

Reverse complement sequence

ATATGACCATCAGTTATAACTTATAAACCGATGAATCTATTATTTCGAACAATTAGATATATCTCGATGAATCTATTATTTCTAACAATTAGATATATGT[C/T]
AAGGATCTGTTTCTAATAAAAAAGAAATCTCCTCTCTCTATATATATACTCCTCCCTCTGTGGTAAGTACGTGAATTTCCTACTTTATTGCTAGCAACCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.30%	6.20%	1.48%	0.00%	NA
All Indica	2759	94.20%	5.10%	0.72%	0.00%	NA
All Japonica	1512	96.20%	2.90%	0.86%	0.00%	NA
Aus	269	47.60%	39.00%	13.38%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	96.80%	2.40%	0.86%	0.00%	NA
Indica III	913	89.50%	9.50%	0.99%	0.00%	NA
Indica Intermediate	786	93.80%	5.30%	0.89%	0.00%	NA
Temperate Japonica	767	97.80%	2.00%	0.26%	0.00%	NA
Tropical Japonica	504	93.30%	4.60%	2.18%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221698940	G -> A	LOC_Os12g35680.1	upstream_gene_variant ; 3342.0bp to feature; MODIFIER	silent_mutation	Average:32.595; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg1221698940	G -> A	LOC_Os12g35690.1	upstream_gene_variant ; 918.0bp to feature; MODIFIER	silent_mutation	Average:32.595; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg1221698940	G -> A	LOC_Os12g35700.1	downstream_gene_variant ; 3485.0bp to feature; MODIFIER	silent_mutation	Average:32.595; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg1221698940	G -> A	LOC_Os12g35680-LOC_Os12g35690	intergenic_region ; MODIFIER	silent_mutation	Average:32.595; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221698940	NA	2.41E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221698940	2.68E-06	9.41E-06	mr1519_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221698940	4.60E-07	4.60E-10	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251