RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1221691088:

Variant ID: vg1221691088 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21691088
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTACTCTGTTAATTCTAATTGTTATAAAATGTTACTCCCTCCGTATTTTAATGTATGACGCAGTTGACTTTGTGACAAACGTTTGACCTTTCGTCTTATT[A/C]
AAAAAAATTATATAATTATCATTTATTTTATTGTGACTTGATTTATCATCAAATGTTCTTTAAACATAACATAAGTATTTTTATATTTGCATAAAAAATT

Reverse complement sequence

AATTTTTTATGCAAATATAAAAATACTTATGTTATGTTTAAAGAACATTTGATGATAAATCAAGTCACAATAAAATAAATGATAATTATATAATTTTTTT[T/G]
AATAAGACGAAAGGTCAAACGTTTGTCACAAAGTCAACTGCGTCATACATTAAAATACGGAGGGAGTAACATTTTATAACAATTAGAATTAACAGAGTAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.70%	25.30%	1.02%	0.00%	NA
All Indica	2759	77.50%	20.80%	1.70%	0.00%	NA
All Japonica	1512	78.00%	21.90%	0.07%	0.00%	NA
Aus	269	12.30%	87.70%	0.00%	0.00%	NA
Indica I	595	80.80%	18.80%	0.34%	0.00%	NA
Indica II	465	69.20%	24.70%	6.02%	0.00%	NA
Indica III	913	77.90%	21.80%	0.33%	0.00%	NA
Indica Intermediate	786	79.30%	19.00%	1.78%	0.00%	NA
Temperate Japonica	767	75.60%	24.30%	0.13%	0.00%	NA
Tropical Japonica	504	89.50%	10.50%	0.00%	0.00%	NA
Japonica Intermediate	241	61.80%	38.20%	0.00%	0.00%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221691088	A -> C	LOC_Os12g35670.1	upstream_gene_variant ; 521.0bp to feature; MODIFIER	silent_mutation	Average:62.469; most accessible tissue: Minghui63 root, score: 90.686	N	N	N	N
vg1221691088	A -> C	LOC_Os12g35680.1	downstream_gene_variant ; 1579.0bp to feature; MODIFIER	silent_mutation	Average:62.469; most accessible tissue: Minghui63 root, score: 90.686	N	N	N	N
vg1221691088	A -> C	LOC_Os12g35660-LOC_Os12g35670	intergenic_region ; MODIFIER	silent_mutation	Average:62.469; most accessible tissue: Minghui63 root, score: 90.686	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221691088	NA	2.51E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221691088	3.37E-06	NA	mr1980	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221691088	NA	9.95E-06	mr1291_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1221691088:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact