\
| Variant ID: vg1221673234 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21673234 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACGGTCAAACATGTTTAAAAAAGTCAACGGCGTCAAACATTTAGGGAAGGAGGTAGTATTATAGTACTCCCTCTGTTTCAAAATATTTGACACCGTTGAC[G/A]
TTGACTTTTTAGTACGTGTTTGACTATTCGTCTTATTAAAAAAATTTAAGTAATTATTTATTCTTTTTATATCATTTGATTCATTGTTAAATATACACTG
CAGTGTATATTTAACAATGAATCAAATGATATAAAAAGAATAAATAATTACTTAAATTTTTTTAATAAGACGAATAGTCAAACACGTACTAAAAAGTCAA[C/T]
GTCAACGGTGTCAAATATTTTGAAACAGAGGGAGTACTATAATACTACCTCCTTCCCTAAATGTTTGACGCCGTTGACTTTTTTAAACATGTTTGACCGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.20% | 5.50% | 0.17% | 3.13% | NA |
| All Indica | 2759 | 94.30% | 0.10% | 0.25% | 5.33% | NA |
| All Japonica | 1512 | 85.10% | 14.80% | 0.07% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 75.70% | 0.00% | 1.08% | 23.23% | NA |
| Indica III | 913 | 99.00% | 0.30% | 0.00% | 0.66% | NA |
| Indica Intermediate | 786 | 95.50% | 0.10% | 0.25% | 4.07% | NA |
| Temperate Japonica | 767 | 82.40% | 17.30% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221673234 | G -> DEL | N | N | silent_mutation | Average:35.19; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg1221673234 | G -> A | LOC_Os12g35640.1 | upstream_gene_variant ; 3855.0bp to feature; MODIFIER | silent_mutation | Average:35.19; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg1221673234 | G -> A | LOC_Os12g35650.1 | downstream_gene_variant ; 581.0bp to feature; MODIFIER | silent_mutation | Average:35.19; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg1221673234 | G -> A | LOC_Os12g35640-LOC_Os12g35650 | intergenic_region ; MODIFIER | silent_mutation | Average:35.19; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221673234 | 3.61E-07 | 6.79E-10 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221673234 | NA | 2.97E-06 | mr1057 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221673234 | 1.92E-08 | 1.07E-14 | mr1057_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221673234 | NA | 5.21E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221673234 | NA | 2.51E-07 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221673234 | NA | 9.85E-07 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221673234 | NA | 3.69E-07 | mr1781_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221673234 | NA | 3.10E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |