\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221673234:

Variant ID: vg1221673234 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21673234
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGGTCAAACATGTTTAAAAAAGTCAACGGCGTCAAACATTTAGGGAAGGAGGTAGTATTATAGTACTCCCTCTGTTTCAAAATATTTGACACCGTTGAC[G/A]
TTGACTTTTTAGTACGTGTTTGACTATTCGTCTTATTAAAAAAATTTAAGTAATTATTTATTCTTTTTATATCATTTGATTCATTGTTAAATATACACTG

Reverse complement sequence

CAGTGTATATTTAACAATGAATCAAATGATATAAAAAGAATAAATAATTACTTAAATTTTTTTAATAAGACGAATAGTCAAACACGTACTAAAAAGTCAA[C/T]
GTCAACGGTGTCAAATATTTTGAAACAGAGGGAGTACTATAATACTACCTCCTTCCCTAAATGTTTGACGCCGTTGACTTTTTTAAACATGTTTGACCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 5.50% 0.17% 3.13% NA
All Indica  2759 94.30% 0.10% 0.25% 5.33% NA
All Japonica  1512 85.10% 14.80% 0.07% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 75.70% 0.00% 1.08% 23.23% NA
Indica III  913 99.00% 0.30% 0.00% 0.66% NA
Indica Intermediate  786 95.50% 0.10% 0.25% 4.07% NA
Temperate Japonica  767 82.40% 17.30% 0.13% 0.13% NA
Tropical Japonica  504 97.20% 2.80% 0.00% 0.00% NA
Japonica Intermediate  241 68.00% 32.00% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221673234 G -> DEL N N silent_mutation Average:35.19; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg1221673234 G -> A LOC_Os12g35640.1 upstream_gene_variant ; 3855.0bp to feature; MODIFIER silent_mutation Average:35.19; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg1221673234 G -> A LOC_Os12g35650.1 downstream_gene_variant ; 581.0bp to feature; MODIFIER silent_mutation Average:35.19; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg1221673234 G -> A LOC_Os12g35640-LOC_Os12g35650 intergenic_region ; MODIFIER silent_mutation Average:35.19; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221673234 3.61E-07 6.79E-10 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234 NA 2.97E-06 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234 1.92E-08 1.07E-14 mr1057_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234 NA 5.21E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234 NA 2.51E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234 NA 9.85E-07 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234 NA 3.69E-07 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234 NA 3.10E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251