\
| Variant ID: vg1221654317 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21654317 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATGATATTTTAGAGCAACTTTCATATAGAAAGTTTTCGTATGAAACACACCGTTTAGCAGTTTGAAAAACGTGCCACGAAAATCTTAATCTTCATCCAA[C/A,T]
TCTTGTTAGAGAAAAAAATGGGACTTGGATGAAAAGTAGTTGTCTTCCTAGAGTTTAAATTTTGTTTTAAATTAGTTGTCACTTTAGAGTACTAGTTGTA
TACAACTAGTACTCTAAAGTGACAACTAATTTAAAACAAAATTTAAACTCTAGGAAGACAACTACTTTTCATCCAAGTCCCATTTTTTTCTCTAACAAGA[G/T,A]
TTGGATGAAGATTAAGATTTTCGTGGCACGTTTTTCAAACTGCTAAACGGTGTGTTTCATACGAAAACTTTCTATATGAAAGTTGCTCTAAAATATCATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 5.00% | 0.02% | 0.00% | T: 0.28% |
| All Indica | 2759 | 99.50% | 0.00% | 0.00% | 0.00% | T: 0.47% |
| All Japonica | 1512 | 84.50% | 15.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 0.00% | 0.00% | 0.00% | T: 1.31% |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.00% | 0.00% | T: 0.13% |
| Temperate Japonica | 767 | 79.80% | 20.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.00% | 27.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221654317 | C -> A | LOC_Os12g35620.1 | upstream_gene_variant ; 626.0bp to feature; MODIFIER | silent_mutation | Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1221654317 | C -> A | LOC_Os12g35610.1 | downstream_gene_variant ; 748.0bp to feature; MODIFIER | silent_mutation | Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1221654317 | C -> A | LOC_Os12g35610.3 | downstream_gene_variant ; 748.0bp to feature; MODIFIER | silent_mutation | Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1221654317 | C -> A | LOC_Os12g35610.2 | downstream_gene_variant ; 747.0bp to feature; MODIFIER | silent_mutation | Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1221654317 | C -> A | LOC_Os12g35610-LOC_Os12g35620 | intergenic_region ; MODIFIER | silent_mutation | Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1221654317 | C -> T | LOC_Os12g35620.1 | upstream_gene_variant ; 626.0bp to feature; MODIFIER | silent_mutation | Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1221654317 | C -> T | LOC_Os12g35610.1 | downstream_gene_variant ; 748.0bp to feature; MODIFIER | silent_mutation | Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1221654317 | C -> T | LOC_Os12g35610.3 | downstream_gene_variant ; 748.0bp to feature; MODIFIER | silent_mutation | Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1221654317 | C -> T | LOC_Os12g35610.2 | downstream_gene_variant ; 747.0bp to feature; MODIFIER | silent_mutation | Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1221654317 | C -> T | LOC_Os12g35610-LOC_Os12g35620 | intergenic_region ; MODIFIER | silent_mutation | Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221654317 | 1.09E-07 | 2.28E-08 | mr1057 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221654317 | NA | 2.97E-06 | mr1057 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221654317 | 4.59E-07 | 4.31E-09 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221654317 | NA | 5.21E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221654317 | NA | 3.69E-07 | mr1781_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |