\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221654317:

Variant ID: vg1221654317 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21654317
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGATATTTTAGAGCAACTTTCATATAGAAAGTTTTCGTATGAAACACACCGTTTAGCAGTTTGAAAAACGTGCCACGAAAATCTTAATCTTCATCCAA[C/A,T]
TCTTGTTAGAGAAAAAAATGGGACTTGGATGAAAAGTAGTTGTCTTCCTAGAGTTTAAATTTTGTTTTAAATTAGTTGTCACTTTAGAGTACTAGTTGTA

Reverse complement sequence

TACAACTAGTACTCTAAAGTGACAACTAATTTAAAACAAAATTTAAACTCTAGGAAGACAACTACTTTTCATCCAAGTCCCATTTTTTTCTCTAACAAGA[G/T,A]
TTGGATGAAGATTAAGATTTTCGTGGCACGTTTTTCAAACTGCTAAACGGTGTGTTTCATACGAAAACTTTCTATATGAAAGTTGCTCTAAAATATCATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 5.00% 0.02% 0.00% T: 0.28%
All Indica  2759 99.50% 0.00% 0.00% 0.00% T: 0.47%
All Japonica  1512 84.50% 15.40% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.70% 0.00% 0.00% 0.00% T: 1.31%
Indica Intermediate  786 99.70% 0.10% 0.00% 0.00% T: 0.13%
Temperate Japonica  767 79.80% 20.10% 0.13% 0.00% NA
Tropical Japonica  504 97.20% 2.80% 0.00% 0.00% NA
Japonica Intermediate  241 73.00% 27.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221654317 C -> A LOC_Os12g35620.1 upstream_gene_variant ; 626.0bp to feature; MODIFIER silent_mutation Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1221654317 C -> A LOC_Os12g35610.1 downstream_gene_variant ; 748.0bp to feature; MODIFIER silent_mutation Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1221654317 C -> A LOC_Os12g35610.3 downstream_gene_variant ; 748.0bp to feature; MODIFIER silent_mutation Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1221654317 C -> A LOC_Os12g35610.2 downstream_gene_variant ; 747.0bp to feature; MODIFIER silent_mutation Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1221654317 C -> A LOC_Os12g35610-LOC_Os12g35620 intergenic_region ; MODIFIER silent_mutation Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1221654317 C -> T LOC_Os12g35620.1 upstream_gene_variant ; 626.0bp to feature; MODIFIER silent_mutation Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1221654317 C -> T LOC_Os12g35610.1 downstream_gene_variant ; 748.0bp to feature; MODIFIER silent_mutation Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1221654317 C -> T LOC_Os12g35610.3 downstream_gene_variant ; 748.0bp to feature; MODIFIER silent_mutation Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1221654317 C -> T LOC_Os12g35610.2 downstream_gene_variant ; 747.0bp to feature; MODIFIER silent_mutation Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1221654317 C -> T LOC_Os12g35610-LOC_Os12g35620 intergenic_region ; MODIFIER silent_mutation Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221654317 1.09E-07 2.28E-08 mr1057 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221654317 NA 2.97E-06 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221654317 4.59E-07 4.31E-09 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221654317 NA 5.21E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221654317 NA 3.69E-07 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251