Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221654317:

Variant ID: vg1221654317 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21654317
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATGATATTTTAGAGCAACTTTCATATAGAAAGTTTTCGTATGAAACACACCGTTTAGCAGTTTGAAAAACGTGCCACGAAAATCTTAATCTTCATCCAA[C/A,T]
TCTTGTTAGAGAAAAAAATGGGACTTGGATGAAAAGTAGTTGTCTTCCTAGAGTTTAAATTTTGTTTTAAATTAGTTGTCACTTTAGAGTACTAGTTGTA

Reverse complement sequence

TACAACTAGTACTCTAAAGTGACAACTAATTTAAAACAAAATTTAAACTCTAGGAAGACAACTACTTTTCATCCAAGTCCCATTTTTTTCTCTAACAAGA[G/T,A]
TTGGATGAAGATTAAGATTTTCGTGGCACGTTTTTCAAACTGCTAAACGGTGTGTTTCATACGAAAACTTTCTATATGAAAGTTGCTCTAAAATATCATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.70%	5.00%	0.02%	0.00%	T: 0.28%
All Indica	2759	99.50%	0.00%	0.00%	0.00%	T: 0.47%
All Japonica	1512	84.50%	15.40%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.70%	0.00%	0.00%	0.00%	T: 1.31%
Indica Intermediate	786	99.70%	0.10%	0.00%	0.00%	T: 0.13%
Temperate Japonica	767	79.80%	20.10%	0.13%	0.00%	NA
Tropical Japonica	504	97.20%	2.80%	0.00%	0.00%	NA
Japonica Intermediate	241	73.00%	27.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221654317	C -> A	LOC_Os12g35620.1	upstream_gene_variant ; 626.0bp to feature; MODIFIER	silent_mutation	Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg1221654317	C -> A	LOC_Os12g35610.1	downstream_gene_variant ; 748.0bp to feature; MODIFIER	silent_mutation	Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg1221654317	C -> A	LOC_Os12g35610.3	downstream_gene_variant ; 748.0bp to feature; MODIFIER	silent_mutation	Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg1221654317	C -> A	LOC_Os12g35610.2	downstream_gene_variant ; 747.0bp to feature; MODIFIER	silent_mutation	Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg1221654317	C -> A	LOC_Os12g35610-LOC_Os12g35620	intergenic_region ; MODIFIER	silent_mutation	Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg1221654317	C -> T	LOC_Os12g35620.1	upstream_gene_variant ; 626.0bp to feature; MODIFIER	silent_mutation	Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg1221654317	C -> T	LOC_Os12g35610.1	downstream_gene_variant ; 748.0bp to feature; MODIFIER	silent_mutation	Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg1221654317	C -> T	LOC_Os12g35610.3	downstream_gene_variant ; 748.0bp to feature; MODIFIER	silent_mutation	Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg1221654317	C -> T	LOC_Os12g35610.2	downstream_gene_variant ; 747.0bp to feature; MODIFIER	silent_mutation	Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg1221654317	C -> T	LOC_Os12g35610-LOC_Os12g35620	intergenic_region ; MODIFIER	silent_mutation	Average:52.028; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221654317	1.09E-07	2.28E-08	mr1057	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221654317	NA	2.97E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221654317	4.59E-07	4.31E-09	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221654317	NA	5.21E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221654317	NA	3.69E-07	mr1781_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251