Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221644281:

Variant ID: vg1221644281 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21644281
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAGCTTGTTCTTCAGTGTGGCCAGGCGTGCTCACTCGTCTACTCTCGGAGATCACCCTGTCATCCCTTCATAAATGGGCGGAGATTTGCAATGGCTGCT[G/A]
TCCGAATGACCCTCCGATGGGATGGGTCATACCTACCTCCACTCCGCTGGAAGGAGGTGCAAAACGGGAGCGCGGTTGTCCGCCTATGACATGACAGGCG

Reverse complement sequence

CGCCTGTCATGTCATAGGCGGACAACCGCGCTCCCGTTTTGCACCTCCTTCCAGCGGAGTGGAGGTAGGTATGACCCATCCCATCGGAGGGTCATTCGGA[C/T]
AGCAGCCATTGCAAATCTCCGCCCATTTATGAAGGGATGACAGGGTGATCTCCGAGAGTAGACGAGTGAGCACGCCTGGCCACACTGAAGAACAAGCTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.90%	6.00%	0.44%	16.67%	NA
All Indica	2759	76.30%	0.00%	0.43%	23.23%	NA
All Japonica	1512	80.70%	18.30%	0.46%	0.60%	NA
Aus	269	56.50%	0.00%	0.74%	42.75%	NA
Indica I	595	77.30%	0.00%	0.34%	22.35%	NA
Indica II	465	87.30%	0.00%	0.43%	12.26%	NA
Indica III	913	66.20%	0.00%	0.88%	32.97%	NA
Indica Intermediate	786	80.80%	0.10%	0.00%	19.08%	NA
Temperate Japonica	767	77.10%	21.50%	0.65%	0.78%	NA
Tropical Japonica	504	96.00%	3.80%	0.00%	0.20%	NA
Japonica Intermediate	241	60.20%	38.20%	0.83%	0.83%	NA
VI/Aromatic	96	82.30%	3.10%	0.00%	14.58%	NA
Intermediate	90	86.70%	3.30%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221644281	G -> DEL	N	N	silent_mutation	Average:61.905; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1221644281	G -> A	LOC_Os12g35590.1	upstream_gene_variant ; 2561.0bp to feature; MODIFIER	silent_mutation	Average:61.905; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1221644281	G -> A	LOC_Os12g35600.1	upstream_gene_variant ; 22.0bp to feature; MODIFIER	silent_mutation	Average:61.905; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1221644281	G -> A	LOC_Os12g35610.1	upstream_gene_variant ; 3842.0bp to feature; MODIFIER	silent_mutation	Average:61.905; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1221644281	G -> A	LOC_Os12g35610.3	upstream_gene_variant ; 3842.0bp to feature; MODIFIER	silent_mutation	Average:61.905; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1221644281	G -> A	LOC_Os12g35610.2	upstream_gene_variant ; 4095.0bp to feature; MODIFIER	silent_mutation	Average:61.905; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1221644281	G -> A	LOC_Os12g35590-LOC_Os12g35600	intergenic_region ; MODIFIER	silent_mutation	Average:61.905; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221644281	6.53E-06	NA	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221644281	NA	5.48E-06	mr1897	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221644281	2.56E-07	2.56E-07	mr1608_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221644281	NA	6.76E-06	mr1736_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251