Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221634445:

Variant ID: vg1221634445 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21634445
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACACGGCTTGGTTAATACGCACGGCGAGAACTCTTACATGACCAGATCTTAGATGGCCGTTTGTCTCTACAGGATCCGACAAGGCCTTATCTGCTCTGG[A/G]
CGTCCTCAGCCGAAGTTCCCTTAGGTTCCTCAGAGGCCTTGTCAGGACGGCGTAAAGGGACATGAGGATAGGTTTCAACTCTAGGTGTCGTCGTGGTAAG

Reverse complement sequence

CTTACCACGACGACACCTAGAGTTGAAACCTATCCTCATGTCCCTTTACGCCGTCCTGACAAGGCCTCTGAGGAACCTAAGGGAACTTCGGCTGAGGACG[T/C]
CCAGAGCAGATAAGGCCTTGTCGGATCCTGTAGAGACAAACGGCCATCTAAGATCTGGTCATGTAAGAGTTCTCGCCGTGCGTATTAACCAAGCCGTGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.40%	17.40%	1.21%	0.00%	NA
All Indica	2759	98.00%	1.50%	0.54%	0.00%	NA
All Japonica	1512	53.60%	44.00%	2.38%	0.00%	NA
Aus	269	88.80%	11.20%	0.00%	0.00%	NA
Indica I	595	97.30%	2.20%	0.50%	0.00%	NA
Indica II	465	98.30%	1.50%	0.22%	0.00%	NA
Indica III	913	99.20%	0.70%	0.11%	0.00%	NA
Indica Intermediate	786	96.80%	1.90%	1.27%	0.00%	NA
Temperate Japonica	767	35.20%	62.70%	2.09%	0.00%	NA
Tropical Japonica	504	70.40%	26.40%	3.17%	0.00%	NA
Japonica Intermediate	241	76.80%	21.60%	1.66%	0.00%	NA
VI/Aromatic	96	43.80%	56.20%	0.00%	0.00%	NA
Intermediate	90	60.00%	33.30%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221634445	A -> G	LOC_Os12g35570.1	upstream_gene_variant ; 4738.0bp to feature; MODIFIER	silent_mutation	Average:62.162; most accessible tissue: Minghui63 young leaf, score: 79.549	N	N	N	N
vg1221634445	A -> G	LOC_Os12g35580.1	upstream_gene_variant ; 2690.0bp to feature; MODIFIER	silent_mutation	Average:62.162; most accessible tissue: Minghui63 young leaf, score: 79.549	N	N	N	N
vg1221634445	A -> G	LOC_Os12g35570.3	upstream_gene_variant ; 4738.0bp to feature; MODIFIER	silent_mutation	Average:62.162; most accessible tissue: Minghui63 young leaf, score: 79.549	N	N	N	N
vg1221634445	A -> G	LOC_Os12g35570.2	upstream_gene_variant ; 4738.0bp to feature; MODIFIER	silent_mutation	Average:62.162; most accessible tissue: Minghui63 young leaf, score: 79.549	N	N	N	N
vg1221634445	A -> G	LOC_Os12g35580.2	upstream_gene_variant ; 2690.0bp to feature; MODIFIER	silent_mutation	Average:62.162; most accessible tissue: Minghui63 young leaf, score: 79.549	N	N	N	N
vg1221634445	A -> G	LOC_Os12g35570-LOC_Os12g35580	intergenic_region ; MODIFIER	silent_mutation	Average:62.162; most accessible tissue: Minghui63 young leaf, score: 79.549	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221634445	4.22E-07	8.63E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634445	NA	8.04E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634445	NA	8.08E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634445	NA	8.63E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634445	NA	5.24E-06	mr1566_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634445	NA	7.22E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634445	2.88E-06	NA	mr1934_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634445	7.76E-06	7.77E-06	mr1934_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251