\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221634437:

Variant ID: vg1221634437 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21634437
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCCGATTACACGGCTTGGTTAATACGCACGGCGAGAACTCTTACATGACCAGATCTTAGATGGCCGTTTGTCTCTACAGGATCCGACAAGGCCTTATC[T/C]
GCTCTGGACGTCCTCAGCCGAAGTTCCCTTAGGTTCCTCAGAGGCCTTGTCAGGACGGCGTAAAGGGACATGAGGATAGGTTTCAACTCTAGGTGTCGTC

Reverse complement sequence

GACGACACCTAGAGTTGAAACCTATCCTCATGTCCCTTTACGCCGTCCTGACAAGGCCTCTGAGGAACCTAAGGGAACTTCGGCTGAGGACGTCCAGAGC[A/G]
GATAAGGCCTTGTCGGATCCTGTAGAGACAAACGGCCATCTAAGATCTGGTCATGTAAGAGTTCTCGCCGTGCGTATTAACCAAGCCGTGTAATCGGAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.00% 28.60% 0.36% 0.00% NA
All Indica  2759 96.70% 2.80% 0.47% 0.00% NA
All Japonica  1512 24.90% 74.90% 0.26% 0.00% NA
Aus  269 88.50% 11.50% 0.00% 0.00% NA
Indica I  595 97.30% 2.20% 0.50% 0.00% NA
Indica II  465 97.00% 2.60% 0.43% 0.00% NA
Indica III  913 98.00% 1.90% 0.11% 0.00% NA
Indica Intermediate  786 94.70% 4.50% 0.89% 0.00% NA
Temperate Japonica  767 30.40% 69.10% 0.52% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 48.50% 51.50% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 61.50% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221634437 T -> C LOC_Os12g35570.1 upstream_gene_variant ; 4730.0bp to feature; MODIFIER silent_mutation Average:60.809; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg1221634437 T -> C LOC_Os12g35580.1 upstream_gene_variant ; 2698.0bp to feature; MODIFIER silent_mutation Average:60.809; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg1221634437 T -> C LOC_Os12g35570.3 upstream_gene_variant ; 4730.0bp to feature; MODIFIER silent_mutation Average:60.809; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg1221634437 T -> C LOC_Os12g35570.2 upstream_gene_variant ; 4730.0bp to feature; MODIFIER silent_mutation Average:60.809; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg1221634437 T -> C LOC_Os12g35580.2 upstream_gene_variant ; 2698.0bp to feature; MODIFIER silent_mutation Average:60.809; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg1221634437 T -> C LOC_Os12g35570-LOC_Os12g35580 intergenic_region ; MODIFIER silent_mutation Average:60.809; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221634437 8.79E-08 NA mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 3.13E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 1.05E-07 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 5.68E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 6.81E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 2.45E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 2.55E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 2.62E-07 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 3.05E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 1.13E-06 7.73E-16 mr1529_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 1.39E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 8.71E-13 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 1.48E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 8.25E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 3.85E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 NA 1.47E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437 7.36E-06 NA mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251