Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221634437:

Variant ID: vg1221634437 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21634437
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCCGATTACACGGCTTGGTTAATACGCACGGCGAGAACTCTTACATGACCAGATCTTAGATGGCCGTTTGTCTCTACAGGATCCGACAAGGCCTTATC[T/C]
GCTCTGGACGTCCTCAGCCGAAGTTCCCTTAGGTTCCTCAGAGGCCTTGTCAGGACGGCGTAAAGGGACATGAGGATAGGTTTCAACTCTAGGTGTCGTC

Reverse complement sequence

GACGACACCTAGAGTTGAAACCTATCCTCATGTCCCTTTACGCCGTCCTGACAAGGCCTCTGAGGAACCTAAGGGAACTTCGGCTGAGGACGTCCAGAGC[A/G]
GATAAGGCCTTGTCGGATCCTGTAGAGACAAACGGCCATCTAAGATCTGGTCATGTAAGAGTTCTCGCCGTGCGTATTAACCAAGCCGTGTAATCGGAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.00%	28.60%	0.36%	0.00%	NA
All Indica	2759	96.70%	2.80%	0.47%	0.00%	NA
All Japonica	1512	24.90%	74.90%	0.26%	0.00%	NA
Aus	269	88.50%	11.50%	0.00%	0.00%	NA
Indica I	595	97.30%	2.20%	0.50%	0.00%	NA
Indica II	465	97.00%	2.60%	0.43%	0.00%	NA
Indica III	913	98.00%	1.90%	0.11%	0.00%	NA
Indica Intermediate	786	94.70%	4.50%	0.89%	0.00%	NA
Temperate Japonica	767	30.40%	69.10%	0.52%	0.00%	NA
Tropical Japonica	504	5.20%	94.80%	0.00%	0.00%	NA
Japonica Intermediate	241	48.50%	51.50%	0.00%	0.00%	NA
VI/Aromatic	96	38.50%	61.50%	0.00%	0.00%	NA
Intermediate	90	40.00%	60.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221634437	T -> C	LOC_Os12g35570.1	upstream_gene_variant ; 4730.0bp to feature; MODIFIER	silent_mutation	Average:60.809; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg1221634437	T -> C	LOC_Os12g35580.1	upstream_gene_variant ; 2698.0bp to feature; MODIFIER	silent_mutation	Average:60.809; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg1221634437	T -> C	LOC_Os12g35570.3	upstream_gene_variant ; 4730.0bp to feature; MODIFIER	silent_mutation	Average:60.809; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg1221634437	T -> C	LOC_Os12g35570.2	upstream_gene_variant ; 4730.0bp to feature; MODIFIER	silent_mutation	Average:60.809; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg1221634437	T -> C	LOC_Os12g35580.2	upstream_gene_variant ; 2698.0bp to feature; MODIFIER	silent_mutation	Average:60.809; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg1221634437	T -> C	LOC_Os12g35570-LOC_Os12g35580	intergenic_region ; MODIFIER	silent_mutation	Average:60.809; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221634437	8.79E-08	NA	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	3.13E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	1.05E-07	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	5.68E-13	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	6.81E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	2.45E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	2.55E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	2.62E-07	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	3.05E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	1.13E-06	7.73E-16	mr1529_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	1.39E-12	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	8.71E-13	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	1.48E-07	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	8.25E-06	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	3.85E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	NA	1.47E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221634437	7.36E-06	NA	mr1934_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251