\
| Variant ID: vg1221632629 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21632629 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 109. )
CCACCGTACTAGTACGGGATTATCTTCGGGAGGTTGAAGATGGTAGTAGACGGTGCGAGCTGGGCTTACGGCTCCCTTTGTTCTAGGTCGAAGGGAAGTA[G/A,C]
GCCAAACGAAGGGAGGTAGTGGACTGACCTAGGCTAAAAAGGAAGGAAGGCTTTCGACCAACGCACGGGTATTTTTTCTAGTTTAGTAATACATAAGAAA
TTTCTTATGTATTACTAAACTAGAAAAAATACCCGTGCGTTGGTCGAAAGCCTTCCTTCCTTTTTAGCCTAGGTCAGTCCACTACCTCCCTTCGTTTGGC[C/T,G]
TACTTCCCTTCGACCTAGAACAAAGGGAGCCGTAAGCCCAGCTCGCACCGTCTACTACCATCTTCAACCTCCCGAAGATAATCCCGTACTAGTACGGTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.00% | 10.00% | 0.00% | 0.00% | C: 0.02% |
| All Indica | 2759 | 87.20% | 12.80% | 0.00% | 0.00% | C: 0.04% |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 61.00% | 39.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.50% | 16.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 82.70% | 17.20% | 0.00% | 0.00% | C: 0.11% |
| Indica Intermediate | 786 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221632629 | G -> C | LOC_Os12g35570.1 | upstream_gene_variant ; 2922.0bp to feature; MODIFIER | silent_mutation | Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1221632629 | G -> C | LOC_Os12g35580.1 | upstream_gene_variant ; 4506.0bp to feature; MODIFIER | silent_mutation | Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1221632629 | G -> C | LOC_Os12g35570.3 | upstream_gene_variant ; 2922.0bp to feature; MODIFIER | silent_mutation | Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1221632629 | G -> C | LOC_Os12g35570.2 | upstream_gene_variant ; 2922.0bp to feature; MODIFIER | silent_mutation | Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1221632629 | G -> C | LOC_Os12g35580.2 | upstream_gene_variant ; 4506.0bp to feature; MODIFIER | silent_mutation | Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1221632629 | G -> C | LOC_Os12g35570-LOC_Os12g35580 | intergenic_region ; MODIFIER | silent_mutation | Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1221632629 | G -> A | LOC_Os12g35570.1 | upstream_gene_variant ; 2922.0bp to feature; MODIFIER | silent_mutation | Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1221632629 | G -> A | LOC_Os12g35580.1 | upstream_gene_variant ; 4506.0bp to feature; MODIFIER | silent_mutation | Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1221632629 | G -> A | LOC_Os12g35570.3 | upstream_gene_variant ; 2922.0bp to feature; MODIFIER | silent_mutation | Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1221632629 | G -> A | LOC_Os12g35570.2 | upstream_gene_variant ; 2922.0bp to feature; MODIFIER | silent_mutation | Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1221632629 | G -> A | LOC_Os12g35580.2 | upstream_gene_variant ; 4506.0bp to feature; MODIFIER | silent_mutation | Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg1221632629 | G -> A | LOC_Os12g35570-LOC_Os12g35580 | intergenic_region ; MODIFIER | silent_mutation | Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221632629 | NA | 5.61E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 6.26E-07 | mr1245 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 7.15E-06 | mr1284 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 6.48E-06 | mr1353 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 1.66E-07 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 7.27E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 5.65E-07 | mr1397 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 8.83E-06 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 6.59E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 3.97E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 4.86E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 5.10E-06 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 4.39E-06 | mr1820 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 4.66E-07 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221632629 | NA | 7.82E-06 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |