\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221632629:

Variant ID: vg1221632629 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21632629
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CCACCGTACTAGTACGGGATTATCTTCGGGAGGTTGAAGATGGTAGTAGACGGTGCGAGCTGGGCTTACGGCTCCCTTTGTTCTAGGTCGAAGGGAAGTA[G/A,C]
GCCAAACGAAGGGAGGTAGTGGACTGACCTAGGCTAAAAAGGAAGGAAGGCTTTCGACCAACGCACGGGTATTTTTTCTAGTTTAGTAATACATAAGAAA

Reverse complement sequence

TTTCTTATGTATTACTAAACTAGAAAAAATACCCGTGCGTTGGTCGAAAGCCTTCCTTCCTTTTTAGCCTAGGTCAGTCCACTACCTCCCTTCGTTTGGC[C/T,G]
TACTTCCCTTCGACCTAGAACAAAGGGAGCCGTAAGCCCAGCTCGCACCGTCTACTACCATCTTCAACCTCCCGAAGATAATCCCGTACTAGTACGGTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 10.00% 0.00% 0.00% C: 0.02%
All Indica  2759 87.20% 12.80% 0.00% 0.00% C: 0.04%
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 61.00% 39.00% 0.00% 0.00% NA
Indica I  595 83.50% 16.50% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 82.70% 17.20% 0.00% 0.00% C: 0.11%
Indica Intermediate  786 89.60% 10.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221632629 G -> C LOC_Os12g35570.1 upstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632629 G -> C LOC_Os12g35580.1 upstream_gene_variant ; 4506.0bp to feature; MODIFIER silent_mutation Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632629 G -> C LOC_Os12g35570.3 upstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632629 G -> C LOC_Os12g35570.2 upstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632629 G -> C LOC_Os12g35580.2 upstream_gene_variant ; 4506.0bp to feature; MODIFIER silent_mutation Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632629 G -> C LOC_Os12g35570-LOC_Os12g35580 intergenic_region ; MODIFIER silent_mutation Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632629 G -> A LOC_Os12g35570.1 upstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632629 G -> A LOC_Os12g35580.1 upstream_gene_variant ; 4506.0bp to feature; MODIFIER silent_mutation Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632629 G -> A LOC_Os12g35570.3 upstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632629 G -> A LOC_Os12g35570.2 upstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632629 G -> A LOC_Os12g35580.2 upstream_gene_variant ; 4506.0bp to feature; MODIFIER silent_mutation Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632629 G -> A LOC_Os12g35570-LOC_Os12g35580 intergenic_region ; MODIFIER silent_mutation Average:55.275; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221632629 NA 5.61E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 6.26E-07 mr1245 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 7.15E-06 mr1284 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 6.48E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 1.66E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 7.27E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 5.65E-07 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 8.83E-06 mr1400 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 6.59E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 3.97E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 4.86E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 5.10E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 4.39E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 4.66E-07 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632629 NA 7.82E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251