\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221621581:

Variant ID: vg1221621581 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21621581
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, T: 0.46, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


CGAGACCATGACTTGGGATGAATTTGAGACCACGTAAGTTTTGTGATTGAAGCATGTTTTTCAGTTGTTGTAAAGTGAACAAATGACAATATATTTTTTT[A/T]
AAAAAAAAAGTGATCAAAATGTTTATGGTCCTTAATATTAGGATTCTGCTGAATGACCTGAATTTTGTAACTCGTGTGAAAATGCTATTGCAGGCGTACT

Reverse complement sequence

AGTACGCCTGCAATAGCATTTTCACACGAGTTACAAAATTCAGGTCATTCAGCAGAATCCTAATATTAAGGACCATAAACATTTTGATCACTTTTTTTTT[T/A]
AAAAAAATATATTGTCATTTGTTCACTTTACAACAACTGAAAAACATGCTTCAATCACAAAACTTACGTGGTCTCAAATTCATCCCAAGTCATGGTCTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 36.20% 1.76% 2.33% NA
All Indica  2759 84.50% 11.70% 2.46% 1.34% NA
All Japonica  1512 24.70% 74.50% 0.66% 0.13% NA
Aus  269 20.10% 53.50% 1.12% 25.28% NA
Indica I  595 84.70% 9.10% 6.22% 0.00% NA
Indica II  465 96.10% 3.40% 0.22% 0.22% NA
Indica III  913 75.80% 20.60% 0.77% 2.85% NA
Indica Intermediate  786 87.50% 8.30% 2.93% 1.27% NA
Temperate Japonica  767 30.10% 68.70% 0.91% 0.26% NA
Tropical Japonica  504 5.60% 93.80% 0.60% 0.00% NA
Japonica Intermediate  241 47.30% 52.70% 0.00% 0.00% NA
VI/Aromatic  96 29.20% 67.70% 1.04% 2.08% NA
Intermediate  90 37.80% 60.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221621581 A -> DEL N N silent_mutation Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1221621581 A -> T LOC_Os12g35550.1 downstream_gene_variant ; 4078.0bp to feature; MODIFIER silent_mutation Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1221621581 A -> T LOC_Os12g35570.1 downstream_gene_variant ; 3866.0bp to feature; MODIFIER silent_mutation Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1221621581 A -> T LOC_Os12g35550.2 downstream_gene_variant ; 4078.0bp to feature; MODIFIER silent_mutation Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1221621581 A -> T LOC_Os12g35570.3 downstream_gene_variant ; 3866.0bp to feature; MODIFIER silent_mutation Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1221621581 A -> T LOC_Os12g35570.2 downstream_gene_variant ; 3872.0bp to feature; MODIFIER silent_mutation Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1221621581 A -> T LOC_Os12g35560.1 intron_variant ; MODIFIER silent_mutation Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221621581 NA 4.85E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221621581 NA 5.14E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221621581 NA 4.19E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221621581 NA 9.77E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221621581 NA 2.36E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221621581 NA 4.09E-11 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221621581 NA 3.35E-08 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221621581 NA 4.68E-06 mr1239_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221621581 NA 9.53E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221621581 NA 2.54E-08 mr1781_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251