\
| Variant ID: vg1221621581 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21621581 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, T: 0.46, others allele: 0.00, population size: 76. )
CGAGACCATGACTTGGGATGAATTTGAGACCACGTAAGTTTTGTGATTGAAGCATGTTTTTCAGTTGTTGTAAAGTGAACAAATGACAATATATTTTTTT[A/T]
AAAAAAAAAGTGATCAAAATGTTTATGGTCCTTAATATTAGGATTCTGCTGAATGACCTGAATTTTGTAACTCGTGTGAAAATGCTATTGCAGGCGTACT
AGTACGCCTGCAATAGCATTTTCACACGAGTTACAAAATTCAGGTCATTCAGCAGAATCCTAATATTAAGGACCATAAACATTTTGATCACTTTTTTTTT[T/A]
AAAAAAATATATTGTCATTTGTTCACTTTACAACAACTGAAAAACATGCTTCAATCACAAAACTTACGTGGTCTCAAATTCATCCCAAGTCATGGTCTCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.70% | 36.20% | 1.76% | 2.33% | NA |
| All Indica | 2759 | 84.50% | 11.70% | 2.46% | 1.34% | NA |
| All Japonica | 1512 | 24.70% | 74.50% | 0.66% | 0.13% | NA |
| Aus | 269 | 20.10% | 53.50% | 1.12% | 25.28% | NA |
| Indica I | 595 | 84.70% | 9.10% | 6.22% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.40% | 0.22% | 0.22% | NA |
| Indica III | 913 | 75.80% | 20.60% | 0.77% | 2.85% | NA |
| Indica Intermediate | 786 | 87.50% | 8.30% | 2.93% | 1.27% | NA |
| Temperate Japonica | 767 | 30.10% | 68.70% | 0.91% | 0.26% | NA |
| Tropical Japonica | 504 | 5.60% | 93.80% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 47.30% | 52.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 67.70% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 37.80% | 60.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221621581 | A -> DEL | N | N | silent_mutation | Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg1221621581 | A -> T | LOC_Os12g35550.1 | downstream_gene_variant ; 4078.0bp to feature; MODIFIER | silent_mutation | Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg1221621581 | A -> T | LOC_Os12g35570.1 | downstream_gene_variant ; 3866.0bp to feature; MODIFIER | silent_mutation | Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg1221621581 | A -> T | LOC_Os12g35550.2 | downstream_gene_variant ; 4078.0bp to feature; MODIFIER | silent_mutation | Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg1221621581 | A -> T | LOC_Os12g35570.3 | downstream_gene_variant ; 3866.0bp to feature; MODIFIER | silent_mutation | Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg1221621581 | A -> T | LOC_Os12g35570.2 | downstream_gene_variant ; 3872.0bp to feature; MODIFIER | silent_mutation | Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg1221621581 | A -> T | LOC_Os12g35560.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.921; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221621581 | NA | 4.85E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221621581 | NA | 5.14E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221621581 | NA | 4.19E-06 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221621581 | NA | 9.77E-06 | mr1807 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221621581 | NA | 2.36E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221621581 | NA | 4.09E-11 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221621581 | NA | 3.35E-08 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221621581 | NA | 4.68E-06 | mr1239_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221621581 | NA | 9.53E-06 | mr1736_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221621581 | NA | 2.54E-08 | mr1781_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |