\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221584421:

Variant ID: vg1221584421 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21584421
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.11, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTCTTCTAAATTCGATGCAAATAGTTGTGAAATTTTTTTAAAAAAAATTAACAATGTAGAGTATAATGACATCTACTACTCCACCAAAATTCAAGTT[C/T]
AAATTCGATCTACACATCGAGAAACAAAAAAGACAAATTTAGATATAAACAATACGCTACTATTCATACGCTAAATTTGTTTATATCTCGACGCGTGAGT

Reverse complement sequence

ACTCACGCGTCGAGATATAAACAAATTTAGCGTATGAATAGTAGCGTATTGTTTATATCTAAATTTGTCTTTTTTGTTTCTCGATGTGTAGATCGAATTT[G/A]
AACTTGAATTTTGGTGGAGTAGTAGATGTCATTATACTCTACATTGTTAATTTTTTTTAAAAAAATTTCACAACTATTTGCATCGAATTTAGAAGAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.90% 20.10% 0.17% 0.87% NA
All Indica  2759 71.60% 26.70% 0.29% 1.45% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 31.20% 68.80% 0.00% 0.00% NA
Indica I  595 66.20% 33.10% 0.67% 0.00% NA
Indica II  465 95.90% 3.90% 0.22% 0.00% NA
Indica III  913 61.80% 35.80% 0.11% 2.30% NA
Indica Intermediate  786 72.60% 24.70% 0.25% 2.42% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221584421 C -> DEL N N silent_mutation Average:41.861; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg1221584421 C -> T LOC_Os12g35490.1 upstream_gene_variant ; 2725.0bp to feature; MODIFIER silent_mutation Average:41.861; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg1221584421 C -> T LOC_Os12g35490-LOC_Os12g35510 intergenic_region ; MODIFIER silent_mutation Average:41.861; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221584421 NA 5.26E-10 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221584421 5.32E-06 2.88E-09 mr1399 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251