Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221584421:

Variant ID: vg1221584421 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21584421
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.11, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTCTTCTAAATTCGATGCAAATAGTTGTGAAATTTTTTTAAAAAAAATTAACAATGTAGAGTATAATGACATCTACTACTCCACCAAAATTCAAGTT[C/T]
AAATTCGATCTACACATCGAGAAACAAAAAAGACAAATTTAGATATAAACAATACGCTACTATTCATACGCTAAATTTGTTTATATCTCGACGCGTGAGT

Reverse complement sequence

ACTCACGCGTCGAGATATAAACAAATTTAGCGTATGAATAGTAGCGTATTGTTTATATCTAAATTTGTCTTTTTTGTTTCTCGATGTGTAGATCGAATTT[G/A]
AACTTGAATTTTGGTGGAGTAGTAGATGTCATTATACTCTACATTGTTAATTTTTTTTAAAAAAATTTCACAACTATTTGCATCGAATTTAGAAGAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.90%	20.10%	0.17%	0.87%	NA
All Indica	2759	71.60%	26.70%	0.29%	1.45%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	31.20%	68.80%	0.00%	0.00%	NA
Indica I	595	66.20%	33.10%	0.67%	0.00%	NA
Indica II	465	95.90%	3.90%	0.22%	0.00%	NA
Indica III	913	61.80%	35.80%	0.11%	2.30%	NA
Indica Intermediate	786	72.60%	24.70%	0.25%	2.42%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221584421	C -> DEL	N	N	silent_mutation	Average:41.861; most accessible tissue: Zhenshan97 flower, score: 65.596	N	N	N	N
vg1221584421	C -> T	LOC_Os12g35490.1	upstream_gene_variant ; 2725.0bp to feature; MODIFIER	silent_mutation	Average:41.861; most accessible tissue: Zhenshan97 flower, score: 65.596	N	N	N	N
vg1221584421	C -> T	LOC_Os12g35490-LOC_Os12g35510	intergenic_region ; MODIFIER	silent_mutation	Average:41.861; most accessible tissue: Zhenshan97 flower, score: 65.596	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221584421	NA	5.26E-10	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221584421	5.32E-06	2.88E-09	mr1399	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251