Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221582274:

Variant ID: vg1221582274 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21582274
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.08, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCTCTCTTATAACATTGTAGGACTACAAACGACACACTTATAACACATGCATAAATTATCTCTGCGAACACATATAGTCCCTCCGTCCAAAAAGAACA[T/G]
ATTCCTAGCATCCCAAGGTTGTTTTAGTTGAGATAGAGAAATACTAAAATGCCCTTGGACATTGAAAAAAAATAGTAGGTGTGATAGGTAGGTAAAGGGT

Reverse complement sequence

ACCCTTTACCTACCTATCACACCTACTATTTTTTTTCAATGTCCAAGGGCATTTTAGTATTTCTCTATCTCAACTAAAACAACCTTGGGATGCTAGGAAT[A/C]
TGTTCTTTTTGGACGGAGGGACTATATGTGTTCGCAGAGATAATTTATGCATGTGTTATAAGTGTGTCGTTTGTAGTCCTACAATGTTATAAGAGAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.60%	30.30%	0.66%	22.41%	NA
All Indica	2759	66.70%	4.30%	1.05%	27.98%	NA
All Japonica	1512	22.10%	77.00%	0.13%	0.79%	NA
Aus	269	1.90%	12.30%	0.00%	85.87%	NA
Indica I	595	73.80%	4.50%	2.69%	18.99%	NA
Indica II	465	82.80%	5.20%	1.08%	10.97%	NA
Indica III	913	50.10%	2.20%	0.11%	47.65%	NA
Indica Intermediate	786	71.10%	6.00%	0.89%	22.01%	NA
Temperate Japonica	767	28.00%	71.30%	0.00%	0.65%	NA
Tropical Japonica	504	4.00%	95.40%	0.00%	0.60%	NA
Japonica Intermediate	241	41.10%	56.40%	0.83%	1.66%	NA
VI/Aromatic	96	2.10%	61.50%	0.00%	36.46%	NA
Intermediate	90	25.60%	64.40%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221582274	T -> DEL	N	N	silent_mutation	Average:49.626; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1221582274	T -> G	LOC_Os12g35490.1	upstream_gene_variant ; 578.0bp to feature; MODIFIER	silent_mutation	Average:49.626; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1221582274	T -> G	LOC_Os12g35490-LOC_Os12g35510	intergenic_region ; MODIFIER	silent_mutation	Average:49.626; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221582274	1.48E-06	NA	mr1057	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	9.02E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	5.02E-21	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	1.84E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	6.29E-09	NA	mr1057_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	8.88E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	3.02E-19	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	4.75E-13	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	3.03E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	2.97E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	5.82E-20	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	3.67E-06	mr1239_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	1.25E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	4.67E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	1.44E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	1.88E-10	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	9.83E-07	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	1.70E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	1.32E-12	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	3.60E-12	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	2.81E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	5.25E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	7.09E-13	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	2.24E-15	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	7.27E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	1.39E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	2.03E-12	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	9.55E-07	mr1781_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	2.14E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274	NA	9.13E-15	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251