\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221582274:

Variant ID: vg1221582274 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21582274
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.08, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCTCTCTTATAACATTGTAGGACTACAAACGACACACTTATAACACATGCATAAATTATCTCTGCGAACACATATAGTCCCTCCGTCCAAAAAGAACA[T/G]
ATTCCTAGCATCCCAAGGTTGTTTTAGTTGAGATAGAGAAATACTAAAATGCCCTTGGACATTGAAAAAAAATAGTAGGTGTGATAGGTAGGTAAAGGGT

Reverse complement sequence

ACCCTTTACCTACCTATCACACCTACTATTTTTTTTCAATGTCCAAGGGCATTTTAGTATTTCTCTATCTCAACTAAAACAACCTTGGGATGCTAGGAAT[A/C]
TGTTCTTTTTGGACGGAGGGACTATATGTGTTCGCAGAGATAATTTATGCATGTGTTATAAGTGTGTCGTTTGTAGTCCTACAATGTTATAAGAGAGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.60% 30.30% 0.66% 22.41% NA
All Indica  2759 66.70% 4.30% 1.05% 27.98% NA
All Japonica  1512 22.10% 77.00% 0.13% 0.79% NA
Aus  269 1.90% 12.30% 0.00% 85.87% NA
Indica I  595 73.80% 4.50% 2.69% 18.99% NA
Indica II  465 82.80% 5.20% 1.08% 10.97% NA
Indica III  913 50.10% 2.20% 0.11% 47.65% NA
Indica Intermediate  786 71.10% 6.00% 0.89% 22.01% NA
Temperate Japonica  767 28.00% 71.30% 0.00% 0.65% NA
Tropical Japonica  504 4.00% 95.40% 0.00% 0.60% NA
Japonica Intermediate  241 41.10% 56.40% 0.83% 1.66% NA
VI/Aromatic  96 2.10% 61.50% 0.00% 36.46% NA
Intermediate  90 25.60% 64.40% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221582274 T -> DEL N N silent_mutation Average:49.626; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1221582274 T -> G LOC_Os12g35490.1 upstream_gene_variant ; 578.0bp to feature; MODIFIER silent_mutation Average:49.626; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1221582274 T -> G LOC_Os12g35490-LOC_Os12g35510 intergenic_region ; MODIFIER silent_mutation Average:49.626; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221582274 1.48E-06 NA mr1057 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 9.02E-06 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 5.02E-21 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 1.84E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 6.29E-09 NA mr1057_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 8.88E-07 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 3.02E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 4.75E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 3.03E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 2.97E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 5.82E-20 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 3.67E-06 mr1239_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 1.25E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 4.67E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 1.44E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 1.88E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 9.83E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 1.70E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 1.32E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 3.60E-12 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 2.81E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 5.25E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 7.09E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 2.24E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 7.27E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 1.39E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 2.03E-12 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 9.55E-07 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 2.14E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221582274 NA 9.13E-15 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251