\
| Variant ID: vg1221533276 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21533276 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTGGTCATTGTTAAGTTGTGAAATCAAAGTTTCTGCGTGCATTGACATCATCAAGGGATGGTGAGAGCTCCTCTTCAATAAGCCTATTACCCATGGGTA[C/T]
TTGTGGAGAGAAGGTTAGATGAGGCAGGTTATAATCTCTTATGTTGCCACCACTCTTTCCAAAGACACTGGTAAGTTCATGTATTAACAAAGTAAGAAGA
TCTTCTTACTTTGTTAATACATGAACTTACCAGTGTCTTTGGAAAGAGTGGTGGCAACATAAGAGATTATAACCTGCCTCATCTAACCTTCTCTCCACAA[G/A]
TACCCATGGGTAATAGGCTTATTGAAGAGGAGCTCTCACCATCCCTTGATGATGTCAATGCACGCAGAAACTTTGATTTCACAACTTAACAATGACCAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 1.30% | 1.18% | 0.00% | NA |
| All Indica | 2759 | 96.60% | 2.10% | 1.38% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.20% | 8.20% | 5.55% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 0.00% | 15.62% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221533276 | C -> T | LOC_Os12g35410.1 | missense_variant ; p.Val997Ile; MODERATE | nonsynonymous_codon ; V997I | Average:56.741; most accessible tissue: Minghui63 flag leaf, score: 82.053 | unknown | unknown | TOLERATED | 0.44 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221533276 | 6.54E-07 | NA | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221533276 | 4.48E-06 | NA | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221533276 | 4.98E-08 | NA | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221533276 | 5.49E-07 | NA | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221533276 | 1.17E-06 | NA | mr1141_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221533276 | 5.20E-06 | NA | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221533276 | 4.17E-07 | NA | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221533276 | 2.52E-06 | NA | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |