\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221513306:

Variant ID: vg1221513306 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21513306
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


GATGCCACTCCCGGTCCCATAGTACAAGTGAGCCCCACGCAGAGGCGTAGCAACTGTGCATCAACTGAGGCTCCGGCAGAATAGCCTGAAGGCCCCGCCG[C/T]
GGTGGACCACATAATGGTAAAAACAACTTAATAACGCATATATTGTATTAGCACCAAAATACATTGCAACATATACTAAGGACACTAATGAATCTATCGC

Reverse complement sequence

GCGATAGATTCATTAGTGTCCTTAGTATATGTTGCAATGTATTTTGGTGCTAATACAATATATGCGTTATTAAGTTGTTTTTACCATTATGTGGTCCACC[G/A]
CGGCGGGGCCTTCAGGCTATTCTGCCGGAGCCTCAGTTGATGCACAGTTGCTACGCCTCTGCGTGGGGCTCACTTGTACTATGGGACCGGGAGTGGCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 11.80% 0.11% 0.61% NA
All Indica  2759 79.20% 19.50% 0.18% 1.05% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 70.90% 29.10% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 76.90% 21.10% 0.22% 1.75% NA
Indica Intermediate  786 78.00% 20.00% 0.38% 1.65% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221513306 C -> DEL N N silent_mutation Average:60.827; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg1221513306 C -> T LOC_Os12g35370.1 downstream_gene_variant ; 4526.0bp to feature; MODIFIER silent_mutation Average:60.827; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg1221513306 C -> T LOC_Os12g35380.1 intron_variant ; MODIFIER silent_mutation Average:60.827; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221513306 NA 2.63E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221513306 NA 7.19E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221513306 7.01E-06 4.55E-11 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221513306 4.40E-06 8.74E-10 mr1399 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221513306 NA 4.16E-06 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251