Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221504344:

Variant ID: vg1221504344 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21504344
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAGAGAAAGAGAGAAGAGGGGAAGAAGAGTATGATAGGTGGGTTCCATATTTTTTATTAAATAAAATGCTGACTCTATTGCCACGCGTCGGCCATGTT[G/A]
GCCAAACTGTTCTAGATTGGGTCGAGAGGGTATTGAAAGTTGAGAGTGAACGATGACTAGTTTTTGGGTTTATGGGTAATTCGGTCGACCGCAATAAATC

Reverse complement sequence

GATTTATTGCGGTCGACCGAATTACCCATAAACCCAAAAACTAGTCATCGTTCACTCTCAACTTTCAATACCCTCTCGACCCAATCTAGAACAGTTTGGC[C/T]
AACATGGCCGACGCGTGGCAATAGAGTCAGCATTTTATTTAATAAAAAATATGGAACCCACCTATCATACTCTTCTTCCCCTCTTCTCTCTTTCTCTTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.50%	6.50%	0.00%	0.00%	NA
All Indica	2759	89.20%	10.80%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	82.40%	17.60%	0.00%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	89.30%	10.70%	0.00%	0.00%	NA
Indica Intermediate	786	90.20%	9.80%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221504344	G -> A	LOC_Os12g35360.1	upstream_gene_variant ; 3500.0bp to feature; MODIFIER	silent_mutation	Average:67.156; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg1221504344	G -> A	LOC_Os12g35364.1	upstream_gene_variant ; 120.0bp to feature; MODIFIER	silent_mutation	Average:67.156; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg1221504344	G -> A	LOC_Os12g35370.1	upstream_gene_variant ; 1251.0bp to feature; MODIFIER	silent_mutation	Average:67.156; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg1221504344	G -> A	LOC_Os12g35364-LOC_Os12g35370	intergenic_region ; MODIFIER	silent_mutation	Average:67.156; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221504344	7.23E-06	6.46E-08	mr1029	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344	NA	7.29E-06	mr1029	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344	NA	7.60E-09	mr1042	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344	NA	1.27E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344	NA	9.13E-07	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344	4.83E-06	9.46E-08	mr1189	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344	NA	6.65E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344	NA	9.72E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344	6.91E-06	9.50E-08	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344	NA	2.81E-08	mr1912	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344	NA	2.26E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251