\
| Variant ID: vg1221504344 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21504344 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )
GAAAGAGAAAGAGAGAAGAGGGGAAGAAGAGTATGATAGGTGGGTTCCATATTTTTTATTAAATAAAATGCTGACTCTATTGCCACGCGTCGGCCATGTT[G/A]
GCCAAACTGTTCTAGATTGGGTCGAGAGGGTATTGAAAGTTGAGAGTGAACGATGACTAGTTTTTGGGTTTATGGGTAATTCGGTCGACCGCAATAAATC
GATTTATTGCGGTCGACCGAATTACCCATAAACCCAAAAACTAGTCATCGTTCACTCTCAACTTTCAATACCCTCTCGACCCAATCTAGAACAGTTTGGC[C/T]
AACATGGCCGACGCGTGGCAATAGAGTCAGCATTTTATTTAATAAAAAATATGGAACCCACCTATCATACTCTTCTTCCCCTCTTCTCTCTTTCTCTTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 82.40% | 17.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.30% | 10.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.20% | 9.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221504344 | G -> A | LOC_Os12g35360.1 | upstream_gene_variant ; 3500.0bp to feature; MODIFIER | silent_mutation | Average:67.156; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg1221504344 | G -> A | LOC_Os12g35364.1 | upstream_gene_variant ; 120.0bp to feature; MODIFIER | silent_mutation | Average:67.156; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg1221504344 | G -> A | LOC_Os12g35370.1 | upstream_gene_variant ; 1251.0bp to feature; MODIFIER | silent_mutation | Average:67.156; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg1221504344 | G -> A | LOC_Os12g35364-LOC_Os12g35370 | intergenic_region ; MODIFIER | silent_mutation | Average:67.156; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221504344 | 7.23E-06 | 6.46E-08 | mr1029 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504344 | NA | 7.29E-06 | mr1029 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504344 | NA | 7.60E-09 | mr1042 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504344 | NA | 1.27E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504344 | NA | 9.13E-07 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504344 | 4.83E-06 | 9.46E-08 | mr1189 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504344 | NA | 6.65E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504344 | NA | 9.72E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504344 | 6.91E-06 | 9.50E-08 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504344 | NA | 2.81E-08 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504344 | NA | 2.26E-07 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |