\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221504344:

Variant ID: vg1221504344 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21504344
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAGAGAAAGAGAGAAGAGGGGAAGAAGAGTATGATAGGTGGGTTCCATATTTTTTATTAAATAAAATGCTGACTCTATTGCCACGCGTCGGCCATGTT[G/A]
GCCAAACTGTTCTAGATTGGGTCGAGAGGGTATTGAAAGTTGAGAGTGAACGATGACTAGTTTTTGGGTTTATGGGTAATTCGGTCGACCGCAATAAATC

Reverse complement sequence

GATTTATTGCGGTCGACCGAATTACCCATAAACCCAAAAACTAGTCATCGTTCACTCTCAACTTTCAATACCCTCTCGACCCAATCTAGAACAGTTTGGC[C/T]
AACATGGCCGACGCGTGGCAATAGAGTCAGCATTTTATTTAATAAAAAATATGGAACCCACCTATCATACTCTTCTTCCCCTCTTCTCTCTTTCTCTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 6.50% 0.00% 0.00% NA
All Indica  2759 89.20% 10.80% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 82.40% 17.60% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 89.30% 10.70% 0.00% 0.00% NA
Indica Intermediate  786 90.20% 9.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221504344 G -> A LOC_Os12g35360.1 upstream_gene_variant ; 3500.0bp to feature; MODIFIER silent_mutation Average:67.156; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1221504344 G -> A LOC_Os12g35364.1 upstream_gene_variant ; 120.0bp to feature; MODIFIER silent_mutation Average:67.156; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1221504344 G -> A LOC_Os12g35370.1 upstream_gene_variant ; 1251.0bp to feature; MODIFIER silent_mutation Average:67.156; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1221504344 G -> A LOC_Os12g35364-LOC_Os12g35370 intergenic_region ; MODIFIER silent_mutation Average:67.156; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221504344 7.23E-06 6.46E-08 mr1029 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344 NA 7.29E-06 mr1029 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344 NA 7.60E-09 mr1042 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344 NA 1.27E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344 NA 9.13E-07 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344 4.83E-06 9.46E-08 mr1189 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344 NA 6.65E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344 NA 9.72E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344 6.91E-06 9.50E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344 NA 2.81E-08 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504344 NA 2.26E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251