\
| Variant ID: vg1221501463 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21501463 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAACCGTTTAAAAATATGTGTTAACGGGGAATAAGAAAAATTAAAGTTTGGAGTCCAAGGAAGATAGTATCGGCAATAACAAAAGGAAAAAGTACAAATT[C/A]
CCCCGAACTATCGCGGTCGACCAAATTACACCTCTGAACCCGAAAACCAGTCATCGTTCACCTTGAATTTTTAATACCGGACAAATTACCTCCGTCGACC
GGTCGACGGAGGTAATTTGTCCGGTATTAAAAATTCAAGGTGAACGATGACTGGTTTTCGGGTTCAGAGGTGTAATTTGGTCGACCGCGATAGTTCGGGG[G/T]
AATTTGTACTTTTTCCTTTTGTTATTGCCGATACTATCTTCCTTGGACTCCAAACTTTAATTTTTCTTATTCCCCGTTAACACATATTTTTAAACGGTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.90% | 7.40% | 3.47% | 20.25% | NA |
| All Indica | 2759 | 57.70% | 12.10% | 5.44% | 24.76% | NA |
| All Japonica | 1512 | 99.10% | 0.20% | 0.00% | 0.66% | NA |
| Aus | 269 | 12.30% | 1.50% | 4.09% | 82.16% | NA |
| Indica I | 595 | 66.70% | 13.80% | 0.67% | 18.82% | NA |
| Indica II | 465 | 70.10% | 6.50% | 15.27% | 8.17% | NA |
| Indica III | 913 | 40.30% | 13.00% | 3.50% | 43.15% | NA |
| Indica Intermediate | 786 | 63.60% | 13.20% | 5.47% | 17.68% | NA |
| Temperate Japonica | 767 | 99.20% | 0.30% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 62.50% | 1.00% | 0.00% | 36.46% | NA |
| Intermediate | 90 | 78.90% | 8.90% | 3.33% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221501463 | C -> DEL | N | N | silent_mutation | Average:61.677; most accessible tissue: Callus, score: 78.877 | N | N | N | N |
| vg1221501463 | C -> A | LOC_Os12g35360.1 | upstream_gene_variant ; 619.0bp to feature; MODIFIER | silent_mutation | Average:61.677; most accessible tissue: Callus, score: 78.877 | N | N | N | N |
| vg1221501463 | C -> A | LOC_Os12g35370.1 | upstream_gene_variant ; 4132.0bp to feature; MODIFIER | silent_mutation | Average:61.677; most accessible tissue: Callus, score: 78.877 | N | N | N | N |
| vg1221501463 | C -> A | LOC_Os12g35364.1 | downstream_gene_variant ; 2154.0bp to feature; MODIFIER | silent_mutation | Average:61.677; most accessible tissue: Callus, score: 78.877 | N | N | N | N |
| vg1221501463 | C -> A | LOC_Os12g35360-LOC_Os12g35364 | intergenic_region ; MODIFIER | silent_mutation | Average:61.677; most accessible tissue: Callus, score: 78.877 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221501463 | NA | 3.04E-06 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221501463 | NA | 1.09E-06 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221501463 | NA | 7.55E-06 | mr1541 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221501463 | NA | 2.73E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221501463 | 2.53E-06 | 2.53E-06 | mr1748 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |