\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221475948:

Variant ID: vg1221475948 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 21475948
Reference Allele: GAAlternative Allele: AA,G,GAA
Primary Allele: GASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAGCAATTTCTACTACGGCTATGTTTAGTTCCCTTCAAACTTCCAAAAATTCTGTCACATTAAATGCTTGGACACATGCATGGAGCATTAAATGTGGAC[GA/AA,G,GAA]
AAAAAAACCAATTACACAGTTTTCATGTAAATTTCGAGACGAATCTTTTGAGCCTAATTTGATAATGTGATGCTACAGTAAATATTTGTTAATGATGAAT

Reverse complement sequence

ATTCATCATTAACAAATATTTACTGTAGCATCACATTATCAAATTAGGCTCAAAAGATTCGTCTCGAAATTTACATGAAAACTGTGTAATTGGTTTTTTT[TC/TT,C,TTC]
GTCCACATTTAATGCTCCATGCATGTGTCCAAGCATTTAATGTGACAGAATTTTTGGAAGTTTGAAGGGAACTAAACATAGCCGTAGTAGAAATTGCTGG

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.30% 16.80% 1.29% 0.00% AA: 7.53%; GAA: 0.06%
All Indica  2759 75.70% 19.20% 1.27% 0.00% AA: 3.77%; GAA: 0.11%
All Japonica  1512 87.40% 0.70% 1.06% 0.00% AA: 10.85%
Aus  269 2.60% 87.00% 0.37% 0.00% AA: 10.04%
Indica I  595 79.70% 17.30% 2.52% 0.00% GAA: 0.50%
Indica II  465 82.60% 5.20% 1.29% 0.00% AA: 10.97%
Indica III  913 66.50% 29.90% 0.00% 0.00% AA: 3.61%
Indica Intermediate  786 79.30% 16.40% 1.78% 0.00% AA: 2.54%
Temperate Japonica  767 96.20% 0.50% 0.39% 0.00% AA: 2.87%
Tropical Japonica  504 71.60% 0.80% 1.79% 0.00% AA: 25.79%
Japonica Intermediate  241 92.10% 1.20% 1.66% 0.00% AA: 4.98%
VI/Aromatic  96 34.40% 10.40% 4.17% 0.00% AA: 51.04%
Intermediate  90 70.00% 11.10% 5.56% 0.00% AA: 13.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221475948 GA -> GAA LOC_Os12g35340.1 upstream_gene_variant ; 4162.0bp to feature; MODIFIER silent_mutation Average:23.583; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N
vg1221475948 GA -> GAA LOC_Os12g35330-LOC_Os12g35340 intergenic_region ; MODIFIER silent_mutation Average:23.583; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N
vg1221475948 GA -> G LOC_Os12g35340.1 upstream_gene_variant ; 4163.0bp to feature; MODIFIER silent_mutation Average:23.583; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N
vg1221475948 GA -> G LOC_Os12g35330-LOC_Os12g35340 intergenic_region ; MODIFIER silent_mutation Average:23.583; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N
vg1221475948 GA -> AA LOC_Os12g35340.1 upstream_gene_variant ; 4164.0bp to feature; MODIFIER silent_mutation Average:23.583; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N
vg1221475948 GA -> AA LOC_Os12g35330-LOC_Os12g35340 intergenic_region ; MODIFIER silent_mutation Average:23.583; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221475948 2.12E-06 NA mr1518 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221475948 NA 2.91E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221475948 2.64E-08 NA mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221475948 NA 2.34E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221475948 NA 1.28E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251