\
| Variant ID: vg1221475948 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 21475948 |
| Reference Allele: GA | Alternative Allele: AA,G,GAA |
| Primary Allele: GA | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCAGCAATTTCTACTACGGCTATGTTTAGTTCCCTTCAAACTTCCAAAAATTCTGTCACATTAAATGCTTGGACACATGCATGGAGCATTAAATGTGGAC[GA/AA,G,GAA]
AAAAAAACCAATTACACAGTTTTCATGTAAATTTCGAGACGAATCTTTTGAGCCTAATTTGATAATGTGATGCTACAGTAAATATTTGTTAATGATGAAT
ATTCATCATTAACAAATATTTACTGTAGCATCACATTATCAAATTAGGCTCAAAAGATTCGTCTCGAAATTTACATGAAAACTGTGTAATTGGTTTTTTT[TC/TT,C,TTC]
GTCCACATTTAATGCTCCATGCATGTGTCCAAGCATTTAATGTGACAGAATTTTTGGAAGTTTGAAGGGAACTAAACATAGCCGTAGTAGAAATTGCTGG
| Populations | Population Size | Frequency of GA(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.30% | 16.80% | 1.29% | 0.00% | AA: 7.53%; GAA: 0.06% |
| All Indica | 2759 | 75.70% | 19.20% | 1.27% | 0.00% | AA: 3.77%; GAA: 0.11% |
| All Japonica | 1512 | 87.40% | 0.70% | 1.06% | 0.00% | AA: 10.85% |
| Aus | 269 | 2.60% | 87.00% | 0.37% | 0.00% | AA: 10.04% |
| Indica I | 595 | 79.70% | 17.30% | 2.52% | 0.00% | GAA: 0.50% |
| Indica II | 465 | 82.60% | 5.20% | 1.29% | 0.00% | AA: 10.97% |
| Indica III | 913 | 66.50% | 29.90% | 0.00% | 0.00% | AA: 3.61% |
| Indica Intermediate | 786 | 79.30% | 16.40% | 1.78% | 0.00% | AA: 2.54% |
| Temperate Japonica | 767 | 96.20% | 0.50% | 0.39% | 0.00% | AA: 2.87% |
| Tropical Japonica | 504 | 71.60% | 0.80% | 1.79% | 0.00% | AA: 25.79% |
| Japonica Intermediate | 241 | 92.10% | 1.20% | 1.66% | 0.00% | AA: 4.98% |
| VI/Aromatic | 96 | 34.40% | 10.40% | 4.17% | 0.00% | AA: 51.04% |
| Intermediate | 90 | 70.00% | 11.10% | 5.56% | 0.00% | AA: 13.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221475948 | GA -> GAA | LOC_Os12g35340.1 | upstream_gene_variant ; 4162.0bp to feature; MODIFIER | silent_mutation | Average:23.583; most accessible tissue: Zhenshan97 flower, score: 28.855 | N | N | N | N |
| vg1221475948 | GA -> GAA | LOC_Os12g35330-LOC_Os12g35340 | intergenic_region ; MODIFIER | silent_mutation | Average:23.583; most accessible tissue: Zhenshan97 flower, score: 28.855 | N | N | N | N |
| vg1221475948 | GA -> G | LOC_Os12g35340.1 | upstream_gene_variant ; 4163.0bp to feature; MODIFIER | silent_mutation | Average:23.583; most accessible tissue: Zhenshan97 flower, score: 28.855 | N | N | N | N |
| vg1221475948 | GA -> G | LOC_Os12g35330-LOC_Os12g35340 | intergenic_region ; MODIFIER | silent_mutation | Average:23.583; most accessible tissue: Zhenshan97 flower, score: 28.855 | N | N | N | N |
| vg1221475948 | GA -> AA | LOC_Os12g35340.1 | upstream_gene_variant ; 4164.0bp to feature; MODIFIER | silent_mutation | Average:23.583; most accessible tissue: Zhenshan97 flower, score: 28.855 | N | N | N | N |
| vg1221475948 | GA -> AA | LOC_Os12g35330-LOC_Os12g35340 | intergenic_region ; MODIFIER | silent_mutation | Average:23.583; most accessible tissue: Zhenshan97 flower, score: 28.855 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221475948 | 2.12E-06 | NA | mr1518 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221475948 | NA | 2.91E-08 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221475948 | 2.64E-08 | NA | mr1676 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221475948 | NA | 2.34E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221475948 | NA | 1.28E-06 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |