Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221176473:

Variant ID: vg1221176473 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21176473
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGCTTCACTCATATATCTAAACTATTAAAATAATATTGCCATAATACTAATAACTGTGGGTAAATTCCTAATCATATAGATATGCGTACGCATTGAAC[T/C]
AAAGTATATATATTCACTCATTTTCTTGAATCATTGGACCATGCTATTCACCAGTAGGTTTAGTCTTAATTATGGTCATTAGCATGGCACCCAATATAAT

Reverse complement sequence

ATTATATTGGGTGCCATGCTAATGACCATAATTAAGACTAAACCTACTGGTGAATAGCATGGTCCAATGATTCAAGAAAATGAGTGAATATATATACTTT[A/G]
GTTCAATGCGTACGCATATCTATATGATTAGGAATTTACCCACAGTTATTAGTATTATGGCAATATTATTTTAATAGTTTAGATATATGAGTGAAGCACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.00%	8.40%	0.61%	0.00%	NA
All Indica	2759	99.20%	0.50%	0.33%	0.00%	NA
All Japonica	1512	78.40%	20.40%	1.19%	0.00%	NA
Aus	269	91.80%	7.80%	0.37%	0.00%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	98.20%	1.10%	0.64%	0.00%	NA
Temperate Japonica	767	98.00%	1.00%	0.91%	0.00%	NA
Tropical Japonica	504	54.40%	44.20%	1.39%	0.00%	NA
Japonica Intermediate	241	66.40%	32.00%	1.66%	0.00%	NA
VI/Aromatic	96	64.60%	35.40%	0.00%	0.00%	NA
Intermediate	90	78.90%	20.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221176473	T -> C	LOC_Os12g34802-LOC_Os12g34810	intergenic_region ; MODIFIER	silent_mutation	Average:29.724; most accessible tissue: Callus, score: 69.019	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221176473	6.16E-06	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	3.24E-06	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	3.80E-06	NA	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	2.50E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	8.98E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	9.98E-07	mr1200_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	9.91E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	5.19E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	2.31E-06	2.30E-06	mr1286_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	8.36E-07	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	3.77E-06	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	1.99E-07	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	9.17E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	1.07E-07	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	9.99E-06	mr1374_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	3.51E-08	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	5.15E-07	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	3.49E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	4.90E-07	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	9.21E-09	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	3.87E-07	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	6.53E-06	2.70E-07	mr1665_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	1.34E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	3.80E-06	9.25E-08	mr1687_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	2.89E-06	4.22E-07	mr1738_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	1.23E-06	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	1.37E-06	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	2.42E-06	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	1.78E-07	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	5.08E-06	mr1832_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	2.05E-06	mr1833_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	8.05E-06	mr1843_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	4.61E-06	2.70E-12	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	4.00E-06	2.50E-15	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	NA	8.40E-06	mr1870_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221176473	7.99E-06	7.97E-06	mr1979_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251