\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221127987:

Variant ID: vg1221127987 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 21127987
Reference Allele: CAlternative Allele: T,CCACTACGCCGGACCAGG,CCACTACGCCGGACCAGGTCA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCAGAGGATTGTGATAGTTGTGCTGAAACTAGGTGAAAGGGATTCCTGTATCATAATTTCTTAACAACGGCTTGACATCAATAGCTCCTGACAAGCAG[C/T,CCACTACGCCGGACCAGG,CCACTACGCCGGACCAGGTCA]
TTTAACATCGACAGCTCCTGACAGGGGCTATTTCATCATAATCAATGCACTAGCTAAGCTCTCCAGGTGTAGAAGCGGAATTGATGTGGTACATGCCAAA

Reverse complement sequence

TTTGGCATGTACCACATCAATTCCGCTTCTACACCTGGAGAGCTTAGCTAGTGCATTGATTATGATGAAATAGCCCCTGTCAGGAGCTGTCGATGTTAAA[G/A,CCTGGTCCGGCGTAGTGG,TGACCTGGTCCGGCGTAGTGG]
CTGCTTGTCAGGAGCTATTGATGTCAAGCCGTTGTTAAGAAATTATGATACAGGAATCCCTTTCACCTAGTTTCAGCACAACTATCACAATCCTCTGCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.50% 11.10% 0.13% 0.00% CCACTACGCCGGACCAGG: 0.13%; CCACTACGCCGGACCAGGTCA: 0.13%
All Indica  2759 88.60% 10.90% 0.14% 0.00% CCACTACGCCGGACCAGG: 0.18%; CCACTACGCCGGACCAGGTCA: 0.18%
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 29.70% 69.50% 0.37% 0.00% CCACTACGCCGGACCAGG: 0.37%
Indica I  595 84.20% 15.80% 0.00% 0.00% NA
Indica II  465 94.20% 5.20% 0.00% 0.00% CCACTACGCCGGACCAGGTCA: 0.43%; CCACTACGCCGGACCAGG: 0.22%
Indica III  913 89.40% 10.00% 0.00% 0.00% CCACTACGCCGGACCAGG: 0.44%; CCACTACGCCGGACCAGGTCA: 0.22%
Indica Intermediate  786 87.70% 11.70% 0.51% 0.00% CCACTACGCCGGACCAGGTCA: 0.13%
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 0.00% 0.00% CCACTACGCCGGACCAGGTCA: 1.04%
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221127987 C -> CCACTACGCCGGACCAGGTCA LOC_Os12g34790.1 downstream_gene_variant ; 4529.0bp to feature; MODIFIER silent_mutation Average:79.252; most accessible tissue: Zhenshan97 flower, score: 94.966 N N N N
vg1221127987 C -> CCACTACGCCGGACCAGGTCA LOC_Os12g34790-LOC_Os12g34796 intergenic_region ; MODIFIER silent_mutation Average:79.252; most accessible tissue: Zhenshan97 flower, score: 94.966 N N N N
vg1221127987 C -> CCACTACGCCGGACCAGG LOC_Os12g34790.1 downstream_gene_variant ; 4529.0bp to feature; MODIFIER silent_mutation Average:79.252; most accessible tissue: Zhenshan97 flower, score: 94.966 N N N N
vg1221127987 C -> CCACTACGCCGGACCAGG LOC_Os12g34790-LOC_Os12g34796 intergenic_region ; MODIFIER silent_mutation Average:79.252; most accessible tissue: Zhenshan97 flower, score: 94.966 N N N N
vg1221127987 C -> T LOC_Os12g34790.1 downstream_gene_variant ; 4528.0bp to feature; MODIFIER silent_mutation Average:79.252; most accessible tissue: Zhenshan97 flower, score: 94.966 N N N N
vg1221127987 C -> T LOC_Os12g34790-LOC_Os12g34796 intergenic_region ; MODIFIER silent_mutation Average:79.252; most accessible tissue: Zhenshan97 flower, score: 94.966 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1221127987 C CCACT* -0.7 -0.55 -0.23 -0.38 -0.46 -0.52
vg1221127987 C T -0.03 -0.04 -0.03 -0.02 -0.07 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221127987 NA 4.85E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 9.68E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 4.51E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 1.77E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 4.86E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 1.17E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 1.54E-08 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 7.91E-07 mr1294 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 9.02E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 6.72E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 6.19E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 9.44E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 2.31E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 2.40E-06 mr1400 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 1.77E-07 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 8.29E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 6.04E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 1.12E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 9.16E-06 9.60E-08 mr1507 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 9.40E-08 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 4.36E-09 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 7.73E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 1.21E-08 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 3.05E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 2.07E-06 mr1809 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 1.46E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 2.35E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 9.75E-11 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 2.36E-07 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221127987 NA 9.91E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251