\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221124807:

Variant ID: vg1221124807 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21124807
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCTTATTAATTAGAGTAATAATTATACTCTATTATCAATTTGTTATTGTATGCCTCGGCTGATTCCTGGACGAGGGTTCACACGCATGTAAGCGTTTG[A/G]
AATTTTGGATAGAAATTCCGGGCGTGACATGTTCAATATTTCAATTTCGGTAGTTCCATCAGGGGTTGACAATACGGCCGAAATTTCGGTTATTTCGGTC

Reverse complement sequence

GACCGAAATAACCGAAATTTCGGCCGTATTGTCAACCCCTGATGGAACTACCGAAATTGAAATATTGAACATGTCACGCCCGGAATTTCTATCCAAAATT[T/C]
CAAACGCTTACATGCGTGTGAACCCTCGTCCAGGAATCAGCCGAGGCATACAATAACAAATTGATAATAGAGTATAATTATTACTCTAATTAATAAGCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 31.20% 0.19% 0.00% NA
All Indica  2759 71.00% 28.70% 0.25% 0.00% NA
All Japonica  1512 57.20% 42.70% 0.07% 0.00% NA
Aus  269 98.10% 1.50% 0.37% 0.00% NA
Indica I  595 96.50% 3.40% 0.17% 0.00% NA
Indica II  465 51.60% 48.00% 0.43% 0.00% NA
Indica III  913 63.20% 36.60% 0.22% 0.00% NA
Indica Intermediate  786 72.30% 27.50% 0.25% 0.00% NA
Temperate Japonica  767 25.00% 74.80% 0.13% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 25.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221124807 A -> G LOC_Os12g34790.1 downstream_gene_variant ; 1348.0bp to feature; MODIFIER silent_mutation Average:26.381; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1221124807 A -> G LOC_Os12g34790-LOC_Os12g34796 intergenic_region ; MODIFIER silent_mutation Average:26.381; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221124807 NA 1.16E-15 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1221124807 NA 1.34E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 8.42E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 3.79E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 2.23E-11 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 2.32E-08 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 1.29E-12 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 3.30E-09 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 2.66E-09 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 9.67E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 3.22E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 9.64E-07 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 1.37E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 2.48E-14 mr1829_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 4.14E-09 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 2.75E-13 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 2.01E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 1.25E-09 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221124807 NA 4.86E-07 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251