\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221097233:

Variant ID: vg1221097233 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21097233
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATTGAAAAAATCTTGTGCTAGTTCACTATTCTAGTTAAGATTCCCTCCTTGTGGCTCCTGAGCACCATCACCTTGTACGCCATGGACTCCTTGAGAAT[T/C]
GTCGCCTTGATCGCTCGTGGAGCCATCGGTAGCACCTTTAGTACTCGGCTGAGCCGAGCCACCTGAAGCTTGTTTCACTTCTCCATCTTTAAAAGAACCG

Reverse complement sequence

CGGTTCTTTTAAAGATGGAGAAGTGAAACAAGCTTCAGGTGGCTCGGCTCAGCCGAGTACTAAAGGTGCTACCGATGGCTCCACGAGCGATCAAGGCGAC[A/G]
ATTCTCAAGGAGTCCATGGCGTACAAGGTGATGGTGCTCAGGAGCCACAAGGAGGGAATCTTAACTAGAATAGTGAACTAGCACAAGATTTTTTCAATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 1.20% 3.85% 27.78% NA
All Indica  2759 54.80% 0.00% 4.17% 41.07% NA
All Japonica  1512 93.10% 3.50% 2.12% 1.32% NA
Aus  269 36.80% 0.40% 8.92% 53.90% NA
Indica I  595 81.50% 0.00% 1.68% 16.81% NA
Indica II  465 47.50% 0.00% 3.01% 49.46% NA
Indica III  913 42.50% 0.00% 5.81% 51.70% NA
Indica Intermediate  786 53.10% 0.00% 4.83% 42.11% NA
Temperate Japonica  767 92.80% 3.70% 2.48% 1.04% NA
Tropical Japonica  504 96.40% 0.60% 0.99% 1.98% NA
Japonica Intermediate  241 86.70% 9.10% 3.32% 0.83% NA
VI/Aromatic  96 91.70% 0.00% 6.25% 2.08% NA
Intermediate  90 76.70% 3.30% 5.56% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221097233 T -> C LOC_Os12g34740.1 synonymous_variant ; p.Thr9Thr; LOW synonymous_codon Average:20.021; most accessible tissue: Callus, score: 38.711 N N N N
vg1221097233 T -> DEL LOC_Os12g34740.1 N frameshift_variant Average:20.021; most accessible tissue: Callus, score: 38.711 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221097233 NA 3.37E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 8.07E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 1.04E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 5.04E-07 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 5.04E-07 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 5.07E-07 8.92E-07 mr1098_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 6.05E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 7.56E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 3.89E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 4.56E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 3.17E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 2.17E-08 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 1.24E-07 3.51E-08 mr1150_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 4.23E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 1.61E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221097233 NA 9.53E-07 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251