\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221096301:

Variant ID: vg1221096301 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21096301
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTTGCTCCTTGTGGCTGTTGTTGCATAGACTCGAACTGACCATACTGACATGCGAACTGGGGCTGAGCCAATCCCCCTGGCTGATATTGGGCTTGTGG[G/A]
GAAGGAGGCTGATATTGATAGCTCAAATTACTCCCTTGGTAATTATGAAGATTCGGCTGGATGTTGCGCACCAAGTGTTCAGGAACCATCTGAGGTATCA

Reverse complement sequence

TGATACCTCAGATGGTTCCTGAACACTTGGTGCGCAACATCCAGCCGAATCTTCATAATTACCAAGGGAGTAATTTGAGCTATCAATATCAGCCTCCTTC[C/T]
CCACAAGCCCAATATCAGCCAGGGGGATTGGCTCAGCCCCAGTTCGCATGTCAGTATGGTCAGTTCGAGTCTATGCAACAACAGCCACAAGGAGCAACTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.70% 29.80% 5.27% 25.18% NA
All Indica  2759 47.00% 10.00% 6.23% 36.75% NA
All Japonica  1512 31.10% 67.60% 0.13% 1.19% NA
Aus  269 1.90% 18.60% 25.65% 53.90% NA
Indica I  595 77.80% 4.70% 2.52% 14.96% NA
Indica II  465 35.90% 17.60% 6.88% 39.57% NA
Indica III  913 35.30% 8.70% 7.78% 48.30% NA
Indica Intermediate  786 43.80% 11.20% 6.87% 38.17% NA
Temperate Japonica  767 5.50% 93.50% 0.00% 1.04% NA
Tropical Japonica  504 73.40% 25.00% 0.40% 1.19% NA
Japonica Intermediate  241 24.10% 74.30% 0.00% 1.66% NA
VI/Aromatic  96 70.80% 24.00% 4.17% 1.04% NA
Intermediate  90 43.30% 41.10% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221096301 G -> DEL LOC_Os12g34740.1 N frameshift_variant Average:34.355; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1221096301 G -> A LOC_Os12g34740.1 synonymous_variant ; p.Ser213Ser; LOW synonymous_codon Average:34.355; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221096301 NA 3.71E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 NA 4.75E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 NA 3.07E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 NA 4.56E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 3.63E-18 2.55E-92 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 1.43E-08 4.68E-11 mr1334 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 9.78E-09 7.12E-24 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 NA 1.48E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 NA 2.06E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 NA 2.46E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 NA 4.83E-06 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 NA 6.85E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 1.14E-20 3.74E-104 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 7.99E-07 6.73E-09 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 1.89E-08 5.23E-29 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 NA 1.31E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 7.99E-08 NA mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221096301 NA 8.08E-13 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251