\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221089137:

Variant ID: vg1221089137 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21089137
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, G: 0.16, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCAACAGTGGTAAGGATATCCAATATGCCCCAGGTTTAATTCCTAACGGAGGTGGGCTATCTCCTCCGGTTATTGGATATGATGCCCCCAAGACCTCA[C/G]
CTCTTCTTCAAGGGCTTATCAGAGAACCAGCTGATGCTGGCAAAAAAAGGAAAACCAGATCGTCGGCTGTAGACATCGCAGCCCCAACTAAGAAGAAGAA

Reverse complement sequence

TTCTTCTTCTTAGTTGGGGCTGCGATGTCTACAGCCGACGATCTGGTTTTCCTTTTTTTGCCAGCATCAGCTGGTTCTCTGATAAGCCCTTGAAGAAGAG[G/C]
TGAGGTCTTGGGGGCATCATATCCAATAACCGGAGGAGATAGCCCACCTCCGTTAGGAATTAAACCTGGGGCATATTGGATATCCTTACCACTGTTGCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.70% 29.60% 0.25% 28.46% NA
All Indica  2759 49.70% 9.70% 0.14% 40.41% NA
All Japonica  1512 31.80% 66.50% 0.07% 1.65% NA
Aus  269 3.30% 28.30% 1.86% 66.54% NA
Indica I  595 79.50% 12.60% 0.34% 7.56% NA
Indica II  465 44.30% 14.60% 0.22% 40.86% NA
Indica III  913 36.10% 1.80% 0.00% 62.10% NA
Indica Intermediate  786 46.10% 14.00% 0.13% 39.82% NA
Temperate Japonica  767 5.90% 93.40% 0.13% 0.65% NA
Tropical Japonica  504 74.60% 22.20% 0.00% 3.17% NA
Japonica Intermediate  241 24.90% 73.40% 0.00% 1.66% NA
VI/Aromatic  96 70.80% 16.70% 0.00% 12.50% NA
Intermediate  90 44.40% 37.80% 2.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221089137 C -> DEL LOC_Os12g34730.1 N frameshift_variant Average:25.395; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg1221089137 C -> G LOC_Os12g34730.1 missense_variant ; p.Pro407Ala; MODERATE nonsynonymous_codon ; P407A Average:25.395; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 unknown unknown TOLERATED 0.38

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221089137 NA 1.08E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 2.69E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 5.52E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 2.90E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 4.58E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 1.79E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 2.02E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 2.40E-07 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 2.50E-07 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 3.50E-08 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 6.95E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 5.90E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 8.65E-06 8.65E-06 mr1234 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 3.96E-11 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 7.05E-07 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 2.34E-18 2.98E-98 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 1.46E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 1.25E-12 1.33E-27 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 4.92E-09 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 7.98E-12 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 1.15E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 1.87E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 2.41E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 3.28E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 1.15E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 2.58E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 7.77E-19 2.65E-108 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 8.67E-08 4.81E-10 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 2.84E-08 4.12E-28 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 NA 3.39E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 6.68E-09 3.02E-52 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221089137 1.15E-06 7.00E-14 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251