\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221086538:

Variant ID: vg1221086538 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21086538
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.21, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


ATATAAACAAGATTAGAGTATCACAAAGATGGAAGCACTAATCCTAAAAACACAATCCGTCATAACGAGTTTTACCTCTTGTTGAAGATCGAAACCGATG[T/C]
AGCTCAACCAGAAAGCAAGAACTCGTTGAAGCAAAACTAAAGCAAAAGGGTGGCGATGCGCCGAAATTGTATTGAACGTGTGTGTTGTTAAATTACATAG

Reverse complement sequence

CTATGTAATTTAACAACACACACGTTCAATACAATTTCGGCGCATCGCCACCCTTTTGCTTTAGTTTTGCTTCAACGAGTTCTTGCTTTCTGGTTGAGCT[A/G]
CATCGGTTTCGATCTTCAACAAGAGGTAAAACTCGTTATGACGGATTGTGTTTTTAGGATTAGTGCTTCCATCTTTGTGATACTCTAATCTTGTTTATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.60% 32.80% 4.42% 22.15% NA
All Indica  2759 48.30% 10.80% 6.16% 34.69% NA
All Japonica  1512 31.40% 67.10% 0.40% 1.06% NA
Aus  269 1.90% 65.40% 10.41% 22.30% NA
Indica I  595 79.30% 12.60% 1.85% 6.22% NA
Indica II  465 37.20% 17.00% 13.98% 31.83% NA
Indica III  913 36.00% 2.50% 5.48% 55.97% NA
Indica Intermediate  786 45.70% 15.50% 5.60% 33.21% NA
Temperate Japonica  767 5.70% 93.40% 0.39% 0.52% NA
Tropical Japonica  504 73.60% 24.20% 0.40% 1.79% NA
Japonica Intermediate  241 24.90% 73.40% 0.41% 1.24% NA
VI/Aromatic  96 70.80% 17.70% 3.12% 8.33% NA
Intermediate  90 42.20% 48.90% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221086538 T -> C LOC_Os12g34730.1 upstream_gene_variant ; 1305.0bp to feature; MODIFIER silent_mutation Average:16.329; most accessible tissue: Callus, score: 22.779 N N N N
vg1221086538 T -> C LOC_Os12g34720.1 downstream_gene_variant ; 1560.0bp to feature; MODIFIER silent_mutation Average:16.329; most accessible tissue: Callus, score: 22.779 N N N N
vg1221086538 T -> C LOC_Os12g34720-LOC_Os12g34730 intergenic_region ; MODIFIER silent_mutation Average:16.329; most accessible tissue: Callus, score: 22.779 N N N N
vg1221086538 T -> DEL N N silent_mutation Average:16.329; most accessible tissue: Callus, score: 22.779 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221086538 NA 2.17E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 2.55E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 1.05E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 8.28E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 4.33E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 5.66E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 5.33E-18 5.15E-90 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 1.07E-08 1.76E-11 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 1.25E-10 1.84E-25 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 3.49E-06 1.27E-06 mr1344 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 3.17E-08 1.82E-09 mr1415 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 8.07E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 1.92E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 3.17E-08 1.82E-09 mr1567 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 4.18E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 3.32E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 9.89E-12 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 1.36E-23 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 2.17E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 3.05E-21 9.59E-103 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 6.56E-09 2.86E-11 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 9.69E-10 9.86E-31 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 3.81E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 5.38E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 NA 4.76E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 6.26E-09 NA mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221086538 2.99E-08 1.26E-14 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251