\
| Variant ID: vg1221084756 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21084756 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 97. )
AGGATGTTGGTAACACTGTCATTGAGGTAGGGAAAGAGGGGGAAGACAAAGCAGTAGTGCTATGGAAGTCAGAAGATTTCTCTCAACCAGATATTTTTGA[C/T]
CAGATGTCTCAGGAGGACGACAAAAGTAATGATTTGTTGAAAAGAATGGATGTGGACTTAAAACTTGGGGGTGTGAAACTATTTACTGATGAAGAGGAGG
CCTCCTCTTCATCAGTAAATAGTTTCACACCCCCAAGTTTTAAGTCCACATCCATTCTTTTCAACAAATCATTACTTTTGTCGTCCTCCTGAGACATCTG[G/A]
TCAAAAATATCTGGTTGAGAGAAATCTTCTGACTTCCATAGCACTACTGCTTTGTCTTCCCCCTCTTTCCCTACCTCAATGACAGTGTTACCAACATCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.80% | 20.30% | 0.04% | 28.82% | NA |
| All Indica | 2759 | 50.40% | 8.80% | 0.00% | 40.78% | NA |
| All Japonica | 1512 | 55.40% | 43.00% | 0.00% | 1.59% | NA |
| Aus | 269 | 14.50% | 15.20% | 0.74% | 69.52% | NA |
| Indica I | 595 | 79.80% | 12.10% | 0.00% | 8.07% | NA |
| Indica II | 465 | 45.60% | 13.50% | 0.00% | 40.86% | NA |
| Indica III | 913 | 36.60% | 1.20% | 0.00% | 62.21% | NA |
| Indica Intermediate | 786 | 47.10% | 12.30% | 0.00% | 40.59% | NA |
| Temperate Japonica | 767 | 24.40% | 75.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 94.40% | 2.60% | 0.00% | 2.98% | NA |
| Japonica Intermediate | 241 | 72.60% | 25.70% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 87.50% | 0.00% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 56.70% | 27.80% | 0.00% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221084756 | C -> DEL | LOC_Os12g34720.1 | N | frameshift_variant | Average:50.441; most accessible tissue: Zhenshan97 young leaf, score: 78.644 | N | N | N | N |
| vg1221084756 | C -> T | LOC_Os12g34720.1 | synonymous_variant ; p.Asp401Asp; LOW | synonymous_codon | Average:50.441; most accessible tissue: Zhenshan97 young leaf, score: 78.644 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221084756 | NA | 3.70E-15 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1221084756 | NA | 4.93E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084756 | NA | 2.05E-08 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084756 | 9.12E-09 | 1.02E-10 | mr1415 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084756 | 9.12E-09 | 1.02E-10 | mr1567 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084756 | NA | 3.71E-07 | mr1806 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084756 | NA | 2.24E-09 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084756 | 5.68E-06 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084756 | 4.27E-07 | 6.35E-10 | mr1334_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084756 | NA | 7.82E-08 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084756 | NA | 1.94E-06 | mr1446_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084756 | NA | 5.26E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084756 | NA | 2.24E-07 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |