\
| Variant ID: vg1221084747 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21084747 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.24, others allele: 0.00, population size: 96. )
CTGCTGAAAAGGATGTTGGTAACACTGTCATTGAGGTAGGGAAAGAGGGGGAAGACAAAGCAGTAGTGCTATGGAAGTCAGAAGATTTCTCTCAACCAGA[T/C]
ATTTTTGACCAGATGTCTCAGGAGGACGACAAAAGTAATGATTTGTTGAAAAGAATGGATGTGGACTTAAAACTTGGGGGTGTGAAACTATTTACTGATG
CATCAGTAAATAGTTTCACACCCCCAAGTTTTAAGTCCACATCCATTCTTTTCAACAAATCATTACTTTTGTCGTCCTCCTGAGACATCTGGTCAAAAAT[A/G]
TCTGGTTGAGAGAAATCTTCTGACTTCCATAGCACTACTGCTTTGTCTTCCCCCTCTTTCCCTACCTCAATGACAGTGTTACCAACATCCTTTTCAGCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.00% | 29.20% | 0.11% | 28.67% | NA |
| All Indica | 2759 | 50.10% | 9.30% | 0.11% | 40.52% | NA |
| All Japonica | 1512 | 32.10% | 66.30% | 0.00% | 1.52% | NA |
| Aus | 269 | 3.30% | 26.40% | 0.37% | 69.89% | NA |
| Indica I | 595 | 79.70% | 12.10% | 0.17% | 8.07% | NA |
| Indica II | 465 | 45.40% | 13.80% | 0.00% | 40.86% | NA |
| Indica III | 913 | 36.30% | 1.90% | 0.22% | 61.66% | NA |
| Indica Intermediate | 786 | 46.60% | 13.10% | 0.00% | 40.33% | NA |
| Temperate Japonica | 767 | 6.30% | 93.10% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 74.80% | 22.20% | 0.00% | 2.98% | NA |
| Japonica Intermediate | 241 | 25.30% | 73.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 70.80% | 16.70% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 45.60% | 37.80% | 1.11% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221084747 | T -> C | LOC_Os12g34720.1 | synonymous_variant ; p.Asp398Asp; LOW | synonymous_codon | Average:50.191; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg1221084747 | T -> DEL | LOC_Os12g34720.1 | N | frameshift_variant | Average:50.191; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221084747 | NA | 5.83E-07 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 2.55E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 5.14E-11 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 3.62E-07 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 5.62E-11 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 1.81E-09 | mr1251 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 4.38E-06 | mr1257 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | 2.08E-21 | 2.81E-101 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | 4.04E-08 | 4.48E-12 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | 1.52E-12 | 3.73E-28 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 3.12E-07 | mr1415 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 3.49E-08 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 3.73E-11 | mr1435 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 4.41E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 2.09E-10 | mr1539 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 3.12E-07 | mr1567 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 3.24E-08 | mr1599 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 2.93E-07 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 9.91E-06 | mr1686 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 8.45E-06 | mr1817 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 9.64E-08 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | 6.67E-24 | 4.70E-114 | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | 7.06E-11 | 1.14E-13 | mr1334_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | 9.04E-13 | 8.08E-34 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | NA | 3.25E-08 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | 2.99E-09 | 2.50E-52 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221084747 | 1.03E-07 | 2.61E-14 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |