\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221084747:

Variant ID: vg1221084747 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21084747
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.24, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCTGAAAAGGATGTTGGTAACACTGTCATTGAGGTAGGGAAAGAGGGGGAAGACAAAGCAGTAGTGCTATGGAAGTCAGAAGATTTCTCTCAACCAGA[T/C]
ATTTTTGACCAGATGTCTCAGGAGGACGACAAAAGTAATGATTTGTTGAAAAGAATGGATGTGGACTTAAAACTTGGGGGTGTGAAACTATTTACTGATG

Reverse complement sequence

CATCAGTAAATAGTTTCACACCCCCAAGTTTTAAGTCCACATCCATTCTTTTCAACAAATCATTACTTTTGTCGTCCTCCTGAGACATCTGGTCAAAAAT[A/G]
TCTGGTTGAGAGAAATCTTCTGACTTCCATAGCACTACTGCTTTGTCTTCCCCCTCTTTCCCTACCTCAATGACAGTGTTACCAACATCCTTTTCAGCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.00% 29.20% 0.11% 28.67% NA
All Indica  2759 50.10% 9.30% 0.11% 40.52% NA
All Japonica  1512 32.10% 66.30% 0.00% 1.52% NA
Aus  269 3.30% 26.40% 0.37% 69.89% NA
Indica I  595 79.70% 12.10% 0.17% 8.07% NA
Indica II  465 45.40% 13.80% 0.00% 40.86% NA
Indica III  913 36.30% 1.90% 0.22% 61.66% NA
Indica Intermediate  786 46.60% 13.10% 0.00% 40.33% NA
Temperate Japonica  767 6.30% 93.10% 0.00% 0.65% NA
Tropical Japonica  504 74.80% 22.20% 0.00% 2.98% NA
Japonica Intermediate  241 25.30% 73.40% 0.00% 1.24% NA
VI/Aromatic  96 70.80% 16.70% 0.00% 12.50% NA
Intermediate  90 45.60% 37.80% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221084747 T -> C LOC_Os12g34720.1 synonymous_variant ; p.Asp398Asp; LOW synonymous_codon Average:50.191; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg1221084747 T -> DEL LOC_Os12g34720.1 N frameshift_variant Average:50.191; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221084747 NA 5.83E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 2.55E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 5.14E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 3.62E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 5.62E-11 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 1.81E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 4.38E-06 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 2.08E-21 2.81E-101 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 4.04E-08 4.48E-12 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 1.52E-12 3.73E-28 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 3.12E-07 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 3.49E-08 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 3.73E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 4.41E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 2.09E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 3.12E-07 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 3.24E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 2.93E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 9.91E-06 mr1686 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 8.45E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 9.64E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 6.67E-24 4.70E-114 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 7.06E-11 1.14E-13 mr1334_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 9.04E-13 8.08E-34 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 NA 3.25E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 2.99E-09 2.50E-52 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221084747 1.03E-07 2.61E-14 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251