Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221072081:

Variant ID: vg1221072081 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21072081
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGTTCTCTCTCTCTCTCTTGCAAATTCAGATTTCAGAAATTACCGATGACTAGTAAGGTGAAAGTATTTCTTGCATTATAAATTCTGAATAATGTTTT[G/T]
CTTCAGTACTTGTTACTACTTACAATTAATAATAGAAAGAACATTAATGGGTGTTCAACAAACTGTACGGAGACAGATATATTAGTGAGCCATCGACATT

Reverse complement sequence

AATGTCGATGGCTCACTAATATATCTGTCTCCGTACAGTTTGTTGAACACCCATTAATGTTCTTTCTATTATTAATTGTAAGTAGTAACAAGTACTGAAG[C/A]
AAAACATTATTCAGAATTTATAATGCAAGAAATACTTTCACCTTACTAGTCATCGGTAATTTCTGAAATCTGAATTTGCAAGAGAGAGAGAGAGAACTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.80%	29.10%	0.21%	29.92%	NA
All Indica	2759	48.10%	9.10%	0.18%	42.55%	NA
All Japonica	1512	32.10%	66.10%	0.13%	1.65%	NA
Aus	269	3.00%	26.00%	1.12%	69.89%	NA
Indica I	595	79.70%	11.90%	0.00%	8.40%	NA
Indica II	465	44.90%	12.70%	0.00%	42.37%	NA
Indica III	913	31.40%	2.60%	0.11%	65.83%	NA
Indica Intermediate	786	45.50%	12.50%	0.51%	41.48%	NA
Temperate Japonica	767	5.90%	93.40%	0.13%	0.65%	NA
Tropical Japonica	504	75.40%	21.20%	0.20%	3.17%	NA
Japonica Intermediate	241	24.90%	73.40%	0.00%	1.66%	NA
VI/Aromatic	96	70.80%	16.70%	0.00%	12.50%	NA
Intermediate	90	43.30%	40.00%	0.00%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221072081	G -> DEL	N	N	silent_mutation	Average:34.335; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg1221072081	G -> T	LOC_Os12g34700.1	downstream_gene_variant ; 3423.0bp to feature; MODIFIER	silent_mutation	Average:34.335; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg1221072081	G -> T	LOC_Os12g34710.1	downstream_gene_variant ; 326.0bp to feature; MODIFIER	silent_mutation	Average:34.335; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg1221072081	G -> T	LOC_Os12g34700-LOC_Os12g34710	intergenic_region ; MODIFIER	silent_mutation	Average:34.335; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221072081	NA	1.39E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	3.15E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	6.99E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	1.09E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	1.43E-10	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	3.46E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	2.79E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	7.77E-06	NA	mr1120	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	1.55E-06	4.62E-08	mr1120	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	7.02E-07	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	3.12E-10	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	9.89E-07	mr1257	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	3.08E-08	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	2.75E-09	1.16E-24	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	9.31E-11	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	1.34E-08	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	8.58E-06	mr1603	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	3.74E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	8.26E-10	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	9.49E-10	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	1.65E-08	3.15E-29	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	5.65E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221072081	NA	1.62E-12	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251