\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221053802:

Variant ID: vg1221053802 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21053802
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTCTTGCCCAATGCATTCCCACAAAAAAGACCTGCAAGAAAGATGTAGAATTGGCACCATTAAAGACCACATCTCTGTTCCTACATAACCAAATTGTC[C/T]
AAAGAAATACAGCTATGCCCACAAAGCATTATTCTCTTGAGCCTAGGTTCAAGACACAATCTAGCTGTCACGCCCCGAACTAGTCCCGACCGGAACTAGC

Reverse complement sequence

GCTAGTTCCGGTCGGGACTAGTTCGGGGCGTGACAGCTAGATTGTGTCTTGAACCTAGGCTCAAGAGAATAATGCTTTGTGGGCATAGCTGTATTTCTTT[G/A]
GACAATTTGGTTATGTAGGAACAGAGATGTGGTCTTTAATGGTGCCAATTCTACATCTTTCTTGCAGGTCTTTTTTGTGGGAATGCATTGGGCAAGAACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.10% 28.40% 0.11% 29.39% NA
All Indica  2759 49.90% 8.30% 0.14% 41.57% NA
All Japonica  1512 32.10% 66.30% 0.00% 1.65% NA
Aus  269 2.60% 26.00% 0.37% 71.00% NA
Indica I  595 79.70% 11.60% 0.00% 8.74% NA
Indica II  465 44.70% 12.30% 0.22% 42.80% NA
Indica III  913 36.40% 1.50% 0.00% 62.10% NA
Indica Intermediate  786 46.30% 11.50% 0.38% 41.86% NA
Temperate Japonica  767 5.90% 93.50% 0.00% 0.65% NA
Tropical Japonica  504 75.80% 21.00% 0.00% 3.17% NA
Japonica Intermediate  241 24.10% 74.30% 0.00% 1.66% NA
VI/Aromatic  96 83.30% 4.20% 0.00% 12.50% NA
Intermediate  90 44.40% 40.00% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221053802 C -> DEL N N silent_mutation Average:28.735; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N
vg1221053802 C -> T LOC_Os12g34670.1 upstream_gene_variant ; 2982.0bp to feature; MODIFIER silent_mutation Average:28.735; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N
vg1221053802 C -> T LOC_Os12g34680.1 upstream_gene_variant ; 27.0bp to feature; MODIFIER silent_mutation Average:28.735; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N
vg1221053802 C -> T LOC_Os12g34680-LOC_Os12g34690 intergenic_region ; MODIFIER silent_mutation Average:28.735; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221053802 NA 1.39E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 3.15E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 1.09E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 1.43E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 3.46E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 2.79E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 7.02E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 3.12E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 9.89E-07 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 5.27E-21 9.13E-108 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 5.66E-12 5.30E-17 mr1334 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 2.75E-09 1.16E-24 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 4.25E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 5.54E-07 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 9.31E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 5.54E-07 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 1.34E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 8.58E-06 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 3.74E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 6.93E-21 3.58E-119 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 1.23E-10 1.12E-14 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 1.65E-08 3.15E-29 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 5.65E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 2.81E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 1.82E-06 6.49E-51 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221053802 NA 1.62E-12 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251