\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221050840:

Variant ID: vg1221050840 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21050840
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCCAGTCAGTGAAAATGTAGACGCCCAACAACGGTGGTGTGACCATCCAATCCGTGTAGGCGAGGGCACCAGTCGGCATCGGCGAACGCCAACCGTGA[A/C,T]
GGCAAAGAAATCAGTCAGCAACAACAAAGGTGGCCGACACGGGTACATGCAAAATAGATCAATCAACATATGAATCTGTTTAGTACCACGAAATATAAAT

Reverse complement sequence

ATTTATATTTCGTGGTACTAAACAGATTCATATGTTGATTGATCTATTTTGCATGTACCCGTGTCGGCCACCTTTGTTGTTGCTGACTGATTTCTTTGCC[T/G,A]
TCACGGTTGGCGTTCGCCGATGCCGACTGGTGCCCTCGCCTACACGGATTGGATGGTCACACCACCGTTGTTGGGCGTCTACATTTTCACTGACTGGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.60% 28.60% 0.25% 29.54% T: 0.02%
All Indica  2759 49.60% 8.30% 0.18% 41.94% T: 0.04%
All Japonica  1512 31.90% 66.30% 0.07% 1.65% NA
Aus  269 2.60% 26.80% 1.12% 69.52% NA
Indica I  595 79.50% 11.60% 0.00% 8.91% NA
Indica II  465 44.70% 11.40% 0.00% 43.87% NA
Indica III  913 35.90% 1.80% 0.33% 61.99% NA
Indica Intermediate  786 45.70% 11.50% 0.25% 42.49% T: 0.13%
Temperate Japonica  767 5.90% 93.50% 0.00% 0.65% NA
Tropical Japonica  504 75.60% 21.20% 0.00% 3.17% NA
Japonica Intermediate  241 23.70% 74.30% 0.41% 1.66% NA
VI/Aromatic  96 70.80% 16.70% 0.00% 12.50% NA
Intermediate  90 43.30% 36.70% 3.33% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221050840 A -> C LOC_Os12g34670.1 upstream_gene_variant ; 20.0bp to feature; MODIFIER silent_mutation Average:63.466; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg1221050840 A -> C LOC_Os12g34680.1 downstream_gene_variant ; 1929.0bp to feature; MODIFIER silent_mutation Average:63.466; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg1221050840 A -> C LOC_Os12g34670-LOC_Os12g34680 intergenic_region ; MODIFIER silent_mutation Average:63.466; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg1221050840 A -> DEL N N silent_mutation Average:63.466; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg1221050840 A -> T LOC_Os12g34670.1 upstream_gene_variant ; 20.0bp to feature; MODIFIER silent_mutation Average:63.466; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg1221050840 A -> T LOC_Os12g34680.1 downstream_gene_variant ; 1929.0bp to feature; MODIFIER silent_mutation Average:63.466; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg1221050840 A -> T LOC_Os12g34670-LOC_Os12g34680 intergenic_region ; MODIFIER silent_mutation Average:63.466; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221050840 NA 1.39E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 3.15E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 1.09E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 1.43E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 3.46E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 2.79E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 7.02E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 4.62E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 3.12E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 9.89E-07 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 3.17E-15 1.17E-87 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 5.70E-06 6.09E-10 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 2.75E-09 1.16E-24 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 3.54E-06 1.50E-08 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 9.31E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 3.54E-06 1.50E-08 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 1.34E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 8.58E-06 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 3.74E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 1.77E-18 8.21E-100 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 4.03E-09 1.82E-11 mr1334_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 1.65E-08 3.15E-29 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 5.65E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050840 NA 1.62E-12 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251