\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221050837:

Variant ID: vg1221050837 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21050837
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GGCAAGCCAGTCAGTGAAAATGTAGACGCCCAACAACGGTGGTGTGACCATCCAATCCGTGTAGGCGAGGGCACCAGTCGGCATCGGCGAACGCCAACCG[T/C]
GAAGGCAAAGAAATCAGTCAGCAACAACAAAGGTGGCCGACACGGGTACATGCAAAATAGATCAATCAACATATGAATCTGTTTAGTACCACGAAATATA

Reverse complement sequence

TATATTTCGTGGTACTAAACAGATTCATATGTTGATTGATCTATTTTGCATGTACCCGTGTCGGCCACCTTTGTTGTTGCTGACTGATTTCTTTGCCTTC[A/G]
CGGTTGGCGTTCGCCGATGCCGACTGGTGCCCTCGCCTACACGGATTGGATGGTCACACCACCGTTGTTGGGCGTCTACATTTTCACTGACTGGCTTGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 29.60% 1.78% 29.50% NA
All Indica  2759 47.90% 8.40% 1.92% 41.83% NA
All Japonica  1512 27.50% 69.40% 1.39% 1.65% NA
Aus  269 2.20% 26.40% 1.49% 69.89% NA
Indica I  595 73.90% 11.60% 5.55% 8.91% NA
Indica II  465 43.20% 11.60% 1.29% 43.87% NA
Indica III  913 35.90% 2.00% 0.33% 61.77% NA
Indica Intermediate  786 44.80% 11.50% 1.40% 42.37% NA
Temperate Japonica  767 2.20% 96.70% 0.39% 0.65% NA
Tropical Japonica  504 69.60% 24.20% 2.98% 3.17% NA
Japonica Intermediate  241 19.90% 77.20% 1.24% 1.66% NA
VI/Aromatic  96 67.70% 16.70% 3.12% 12.50% NA
Intermediate  90 43.30% 36.70% 3.33% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221050837 T -> C LOC_Os12g34670.1 upstream_gene_variant ; 17.0bp to feature; MODIFIER silent_mutation Average:63.443; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N
vg1221050837 T -> C LOC_Os12g34680.1 downstream_gene_variant ; 1932.0bp to feature; MODIFIER silent_mutation Average:63.443; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N
vg1221050837 T -> C LOC_Os12g34670-LOC_Os12g34680 intergenic_region ; MODIFIER silent_mutation Average:63.443; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N
vg1221050837 T -> DEL N N silent_mutation Average:63.443; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221050837 NA 6.71E-07 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 NA 1.37E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 NA 2.37E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 3.43E-11 1.05E-84 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 1.60E-06 7.93E-11 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 NA 1.93E-15 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 1.84E-07 3.02E-10 mr1415 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 1.84E-07 3.02E-10 mr1567 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 NA 1.70E-08 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 6.91E-13 1.90E-94 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 5.27E-10 1.57E-12 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 NA 4.96E-17 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 NA 1.55E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221050837 NA 1.12E-08 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251