\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221035693:

Variant ID: vg1221035693 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21035693
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AATTAAAGGGACTACAAACTGCATGTGCTATTAGCTTGGTTTAATTAAAAGAGAAAGAGAGAAGAACAGTTCTACTTTTTCAATATTTTTAGAGGGCTTC[T/A]
ATGGGTATCTGTTTGGCATAACCTAGGGTCAAGGAGGCTCTGATACCAACTTGTCACGCCCGGAATTTCTATCCAAAATTCCAAACTCTTACATGTGTGT

Reverse complement sequence

ACACACATGTAAGAGTTTGGAATTTTGGATAGAAATTCCGGGCGTGACAAGTTGGTATCAGAGCCTCCTTGACCCTAGGTTATGCCAAACAGATACCCAT[A/T]
GAAGCCCTCTAAAAATATTGAAAAAGTAGAACTGTTCTTCTCTCTTTCTCTTTTAATTAAACCAAGCTAATAGCACATGCAGTTTGTAGTCCCTTTAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.50% 31.30% 3.22% 24.02% NA
All Indica  2759 49.40% 11.70% 4.31% 34.54% NA
All Japonica  1512 32.00% 66.40% 0.20% 1.39% NA
Aus  269 2.60% 35.70% 7.06% 54.65% NA
Indica I  595 79.00% 13.30% 0.67% 7.06% NA
Indica II  465 44.70% 17.40% 1.94% 35.91% NA
Indica III  913 35.60% 3.60% 7.67% 53.12% NA
Indica Intermediate  786 45.80% 16.70% 4.58% 32.95% NA
Temperate Japonica  767 6.00% 93.40% 0.00% 0.65% NA
Tropical Japonica  504 75.40% 21.60% 0.40% 2.58% NA
Japonica Intermediate  241 24.10% 74.30% 0.41% 1.24% NA
VI/Aromatic  96 70.80% 17.70% 7.29% 4.17% NA
Intermediate  90 43.30% 41.10% 4.44% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221035693 T -> DEL N N silent_mutation Average:26.481; most accessible tissue: Minghui63 flag leaf, score: 42.823 N N N N
vg1221035693 T -> A LOC_Os12g34650.1 intron_variant ; MODIFIER silent_mutation Average:26.481; most accessible tissue: Minghui63 flag leaf, score: 42.823 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221035693 NA 6.28E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 NA 1.20E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 NA 3.70E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 NA 6.72E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 NA 6.36E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 NA 9.19E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 NA 5.44E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 NA 7.03E-06 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 7.00E-13 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 3.27E-11 3.32E-26 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 NA 3.08E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 NA 1.87E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 NA 2.00E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 2.50E-20 1.66E-97 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 3.59E-10 1.41E-12 mr1334_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 3.23E-11 1.25E-31 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 NA 4.61E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 1.81E-08 NA mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221035693 9.32E-07 2.14E-13 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251