Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221031728:

Variant ID: vg1221031728 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21031728
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TAGATGCGTCGCAGTACACTTGTAAACCCTTCTTTGGATCAGGTAAAATCAAAATGGGTGCTGATAGCAAGCGATTTTTCAACTCTTGAAAACAATGCTC[A/T]
CATTCTTCCGACCACTTGTACTTCACATCTTTCTGAAGCAGTCGTGTCATAGGCTTAGCAATCTTGGAAAAATTCTCTATAAACCTTCGGTAATAGCCTG

Reverse complement sequence

CAGGCTATTACCGAAGGTTTATAGAGAATTTTTCCAAGATTGCTAAGCCTATGACACGACTGCTTCAGAAAGATGTGAAGTACAAGTGGTCGGAAGAATG[T/A]
GAGCATTGTTTTCAAGAGTTGAAAAATCGCTTGCTATCAGCACCCATTTTGATTTTACCTGATCCAAAGAAGGGTTTACAAGTGTACTGCGACGCATCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.60%	30.40%	26.28%	1.78%	NA
All Indica	2759	49.60%	10.90%	36.72%	2.75%	NA
All Japonica	1512	31.90%	66.40%	1.52%	0.13%	NA
Aus	269	2.60%	27.90%	68.40%	1.12%	NA
Indica I	595	79.20%	12.90%	7.06%	0.84%	NA
Indica II	465	44.70%	15.10%	31.83%	8.39%	NA
Indica III	913	36.00%	4.30%	58.60%	1.10%	NA
Indica Intermediate	786	45.80%	14.80%	36.64%	2.80%	NA
Temperate Japonica	767	5.70%	93.60%	0.39%	0.26%	NA
Tropical Japonica	504	75.60%	21.20%	3.17%	0.00%	NA
Japonica Intermediate	241	24.10%	74.30%	1.66%	0.00%	NA
VI/Aromatic	96	70.80%	17.70%	9.38%	2.08%	NA
Intermediate	90	43.30%	41.10%	14.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221031728	A -> DEL	LOC_Os12g34650.1	N	frameshift_variant	Average:30.55; most accessible tissue: Minghui63 flag leaf, score: 42.823	N	N	N	N
vg1221031728	A -> T	LOC_Os12g34650.1	N	stop_gained	Average:30.55; most accessible tissue: Minghui63 flag leaf, score: 42.823	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221031728	NA	9.74E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	4.78E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	2.58E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	2.02E-11	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	7.05E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	2.65E-07	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	8.83E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	1.31E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	3.01E-11	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	6.20E-10	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	9.06E-07	mr1257	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	1.61E-17	9.14E-99	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	1.29E-07	6.39E-10	mr1334	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	3.30E-11	3.84E-27	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	2.48E-08	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	1.12E-11	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	4.24E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	1.01E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	2.27E-08	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	4.45E-07	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	8.17E-10	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	1.47E-06	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	6.09E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	5.32E-22	3.98E-114	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	1.36E-08	1.51E-10	mr1334_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	8.17E-11	3.64E-32	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	NA	3.39E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	3.94E-07	NA	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221031728	1.07E-06	1.05E-13	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251