\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221003294:

Variant ID: vg1221003294 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21003294
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCTCAGCTTGGTTTTCTATAGGTGTCGGTTCTTTAATTAACTGGCACCTATAATATTTTATTGATATCAGTTCTTTTAAAAGACCAACACCTACTCCC[T/C]
CCATCCAAAAAAAACTAACCTAGTACTAGGATGGGACAAAAACCAACACCTACTCCCTCTGTCCCAAAAAAAGCTAACCTAGTACTAGGATGGGACATAT

Reverse complement sequence

ATATGTCCCATCCTAGTACTAGGTTAGCTTTTTTTGGGACAGAGGGAGTAGGTGTTGGTTTTTGTCCCATCCTAGTACTAGGTTAGTTTTTTTTGGATGG[A/G]
GGGAGTAGGTGTTGGTCTTTTAAAAGAACTGATATCAATAAAATATTATAGGTGCCAGTTAATTAAAGAACCGACACCTATAGAAAACCAAGCTGAGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 19.00% 0.13% 39.06% NA
All Indica  2759 49.30% 1.50% 0.14% 49.08% NA
All Japonica  1512 33.20% 54.40% 0.13% 12.30% NA
Aus  269 3.30% 3.00% 0.00% 93.68% NA
Indica I  595 78.80% 1.20% 0.00% 20.00% NA
Indica II  465 43.90% 3.70% 0.43% 52.04% NA
Indica III  913 35.70% 0.50% 0.11% 63.64% NA
Indica Intermediate  786 45.80% 1.70% 0.13% 52.42% NA
Temperate Japonica  767 6.80% 86.00% 0.13% 7.04% NA
Tropical Japonica  504 77.40% 6.30% 0.00% 16.27% NA
Japonica Intermediate  241 24.90% 53.90% 0.41% 20.75% NA
VI/Aromatic  96 68.80% 2.10% 0.00% 29.17% NA
Intermediate  90 44.40% 26.70% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221003294 T -> C LOC_Os12g34630-LOC_Os12g34640 intergenic_region ; MODIFIER silent_mutation Average:57.23; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg1221003294 T -> DEL N N silent_mutation Average:57.23; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221003294 5.63E-06 NA mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221003294 2.77E-06 NA mr1232 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221003294 NA 8.30E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221003294 NA 3.31E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221003294 8.61E-08 3.93E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221003294 NA 2.55E-08 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221003294 NA 5.93E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221003294 NA 1.34E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221003294 NA 1.42E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221003294 NA 8.33E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221003294 NA 5.50E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251