\
| Variant ID: vg1221003277 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21003277 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CATGCGGGTCGACTCGCCGGCTCAGCTTGGTTTTCTATAGGTGTCGGTTCTTTAATTAACTGGCACCTATAATATTTTATTGATATCAGTTCTTTTAAAA[G/A]
ACCAACACCTACTCCCTCCATCCAAAAAAAACTAACCTAGTACTAGGATGGGACAAAAACCAACACCTACTCCCTCTGTCCCAAAAAAAGCTAACCTAGT
ACTAGGTTAGCTTTTTTTGGGACAGAGGGAGTAGGTGTTGGTTTTTGTCCCATCCTAGTACTAGGTTAGTTTTTTTTGGATGGAGGGAGTAGGTGTTGGT[C/T]
TTTTAAAAGAACTGATATCAATAAAATATTATAGGTGCCAGTTAATTAAAGAACCGACACCTATAGAAAACCAAGCTGAGCCGGCGAGTCGACCCGCATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.90% | 19.00% | 0.15% | 38.95% | NA |
| All Indica | 2759 | 49.30% | 1.50% | 0.14% | 49.04% | NA |
| All Japonica | 1512 | 33.30% | 54.50% | 0.13% | 12.10% | NA |
| Aus | 269 | 3.30% | 3.00% | 0.37% | 93.31% | NA |
| Indica I | 595 | 79.00% | 1.00% | 0.00% | 20.00% | NA |
| Indica II | 465 | 43.70% | 3.90% | 0.43% | 52.04% | NA |
| Indica III | 913 | 35.70% | 0.70% | 0.11% | 63.53% | NA |
| Indica Intermediate | 786 | 45.90% | 1.50% | 0.13% | 52.42% | NA |
| Temperate Japonica | 767 | 6.90% | 86.00% | 0.26% | 6.78% | NA |
| Tropical Japonica | 504 | 77.40% | 6.50% | 0.00% | 16.07% | NA |
| Japonica Intermediate | 241 | 24.90% | 54.40% | 0.00% | 20.75% | NA |
| VI/Aromatic | 96 | 68.80% | 2.10% | 0.00% | 29.17% | NA |
| Intermediate | 90 | 44.40% | 26.70% | 0.00% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221003277 | G -> DEL | N | N | silent_mutation | Average:56.491; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| vg1221003277 | G -> A | LOC_Os12g34630-LOC_Os12g34640 | intergenic_region ; MODIFIER | silent_mutation | Average:56.491; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221003277 | 8.06E-06 | NA | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221003277 | NA | 3.31E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221003277 | 2.88E-08 | 2.16E-07 | mr1057_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221003277 | NA | 2.55E-08 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221003277 | NA | 2.42E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221003277 | NA | 1.34E-06 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221003277 | NA | 1.34E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221003277 | NA | 4.81E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221003277 | NA | 3.21E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221003277 | NA | 1.31E-09 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |