\
| Variant ID: vg1220952777 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20952777 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTATTAAAAAGGAGTAAAAGTTACAAGAAAAACACCATAATGCACCAAAGTACATGACCACACACCACGCGCTACCACCCAAGCACAAACCACTGAGAGT[G/C]
GAGCCTAGCACCAAACAACCCCCGGTAAGCGTGACTGAAGAACACAGCTAGGCCTACGACAACACCACAGAGACGATACTTCAAAAATGATACCACCACA
TGTGGTGGTATCATTTTTGAAGTATCGTCTCTGTGGTGTTGTCGTAGGCCTAGCTGTGTTCTTCAGTCACGCTTACCGGGGGTTGTTTGGTGCTAGGCTC[C/G]
ACTCTCAGTGGTTTGTGCTTGGGTGGTAGCGCGTGGTGTGTGGTCATGTACTTTGGTGCATTATGGTGTTTTTCTTGTAACTTTTACTCCTTTTTAATAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.00% | 39.60% | 0.32% | 3.00% | NA |
| All Indica | 2759 | 53.20% | 46.30% | 0.33% | 0.18% | NA |
| All Japonica | 1512 | 59.80% | 32.50% | 0.26% | 7.41% | NA |
| Aus | 269 | 91.80% | 2.20% | 0.00% | 5.95% | NA |
| Indica I | 595 | 24.50% | 75.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 57.40% | 42.40% | 0.00% | 0.22% | NA |
| Indica III | 913 | 66.80% | 32.40% | 0.55% | 0.22% | NA |
| Indica Intermediate | 786 | 56.50% | 43.10% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 89.30% | 6.10% | 0.26% | 4.30% | NA |
| Tropical Japonica | 504 | 14.10% | 76.40% | 0.40% | 9.13% | NA |
| Japonica Intermediate | 241 | 61.40% | 24.90% | 0.00% | 13.69% | NA |
| VI/Aromatic | 96 | 28.10% | 65.60% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 56.70% | 37.80% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220952777 | G -> C | LOC_Os12g34560-LOC_Os12g34580 | intergenic_region ; MODIFIER | silent_mutation | Average:41.406; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg1220952777 | G -> DEL | N | N | silent_mutation | Average:41.406; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220952777 | NA | 4.96E-06 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | NA | 1.86E-07 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | NA | 3.05E-10 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | NA | 4.73E-08 | mr1094 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | NA | 2.42E-08 | mr1096 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | NA | 2.35E-08 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | NA | 1.91E-06 | mr1257 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | 5.07E-06 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | 5.24E-09 | 1.30E-22 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | NA | 2.11E-08 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | NA | 4.49E-08 | mr1599 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | NA | 3.17E-06 | mr1603 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | NA | 1.39E-06 | mr1798 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | NA | 3.42E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | 6.29E-07 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | 8.56E-07 | 5.86E-24 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | 8.91E-06 | 8.89E-06 | mr1525_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | NA | 1.35E-07 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220952777 | 7.00E-06 | 6.51E-13 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |