Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220938287:

Variant ID: vg1220938287 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20938287
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAATTTTTTTATAATTCGTATTTTTATTGTTGTTAGATGATAAAATATGATTAATACTTTGTGCGTGACTTGTCTTTTTAATTTTTTTCATAATTTTTT[C/T]
AAATAAGACTGACAGTCAAACGTTGGGCACGAAAACCAGGGTTTGTCTTTTTTTTAGGACGGAGGGAGTATGTTGTAAGCGCACGCACGCACATAATTTG

Reverse complement sequence

CAAATTATGTGCGTGCGTGCGCTTACAACATACTCCCTCCGTCCTAAAAAAAAGACAAACCCTGGTTTTCGTGCCCAACGTTTGACTGTCAGTCTTATTT[G/A]
AAAAAATTATGAAAAAAATTAAAAAGACAAGTCACGCACAAAGTATTAATCATATTTTATCATCTAACAACAATAAAAATACGAATTATAAAAAAATTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.10%	6.60%	0.19%	3.07%	NA
All Indica	2759	97.10%	2.70%	0.07%	0.14%	NA
All Japonica	1512	91.70%	0.30%	0.33%	7.61%	NA
Aus	269	13.80%	79.60%	0.74%	5.95%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	99.40%	0.40%	0.00%	0.22%	NA
Indica III	913	95.90%	3.70%	0.11%	0.22%	NA
Indica Intermediate	786	95.40%	4.30%	0.13%	0.13%	NA
Temperate Japonica	767	95.00%	0.30%	0.13%	4.56%	NA
Tropical Japonica	504	89.90%	0.20%	0.60%	9.33%	NA
Japonica Intermediate	241	85.10%	0.80%	0.41%	13.69%	NA
VI/Aromatic	96	82.30%	12.50%	0.00%	5.21%	NA
Intermediate	90	84.40%	10.00%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220938287	C -> DEL	N	N	silent_mutation	Average:36.621; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1220938287	C -> T	LOC_Os12g34560.1	downstream_gene_variant ; 1031.0bp to feature; MODIFIER	silent_mutation	Average:36.621; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1220938287	C -> T	LOC_Os12g34550-LOC_Os12g34560	intergenic_region ; MODIFIER	silent_mutation	Average:36.621; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220938287	NA	3.48E-18	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	5.74E-21	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	5.62E-20	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	3.72E-19	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	3.80E-21	mr1120	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	2.44E-16	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	5.66E-20	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	2.05E-22	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	1.50E-14	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	4.22E-11	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	2.11E-06	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	8.40E-19	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	7.53E-31	mr1098_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	4.45E-20	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	1.45E-19	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	1.21E-22	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	1.31E-20	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	1.28E-22	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	6.00E-23	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	1.08E-21	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	8.24E-23	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	4.45E-13	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	2.93E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	3.10E-06	NA	mr1793_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	1.85E-14	mr1911_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287	NA	1.91E-17	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251