\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220938287:

Variant ID: vg1220938287 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20938287
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAATTTTTTTATAATTCGTATTTTTATTGTTGTTAGATGATAAAATATGATTAATACTTTGTGCGTGACTTGTCTTTTTAATTTTTTTCATAATTTTTT[C/T]
AAATAAGACTGACAGTCAAACGTTGGGCACGAAAACCAGGGTTTGTCTTTTTTTTAGGACGGAGGGAGTATGTTGTAAGCGCACGCACGCACATAATTTG

Reverse complement sequence

CAAATTATGTGCGTGCGTGCGCTTACAACATACTCCCTCCGTCCTAAAAAAAAGACAAACCCTGGTTTTCGTGCCCAACGTTTGACTGTCAGTCTTATTT[G/A]
AAAAAATTATGAAAAAAATTAAAAAGACAAGTCACGCACAAAGTATTAATCATATTTTATCATCTAACAACAATAAAAATACGAATTATAAAAAAATTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 6.60% 0.19% 3.07% NA
All Indica  2759 97.10% 2.70% 0.07% 0.14% NA
All Japonica  1512 91.70% 0.30% 0.33% 7.61% NA
Aus  269 13.80% 79.60% 0.74% 5.95% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 99.40% 0.40% 0.00% 0.22% NA
Indica III  913 95.90% 3.70% 0.11% 0.22% NA
Indica Intermediate  786 95.40% 4.30% 0.13% 0.13% NA
Temperate Japonica  767 95.00% 0.30% 0.13% 4.56% NA
Tropical Japonica  504 89.90% 0.20% 0.60% 9.33% NA
Japonica Intermediate  241 85.10% 0.80% 0.41% 13.69% NA
VI/Aromatic  96 82.30% 12.50% 0.00% 5.21% NA
Intermediate  90 84.40% 10.00% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220938287 C -> DEL N N silent_mutation Average:36.621; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1220938287 C -> T LOC_Os12g34560.1 downstream_gene_variant ; 1031.0bp to feature; MODIFIER silent_mutation Average:36.621; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1220938287 C -> T LOC_Os12g34550-LOC_Os12g34560 intergenic_region ; MODIFIER silent_mutation Average:36.621; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220938287 NA 3.48E-18 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 5.74E-21 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 5.62E-20 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 3.72E-19 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 3.80E-21 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 2.44E-16 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 5.66E-20 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 2.05E-22 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 1.50E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 4.22E-11 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 2.11E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 8.40E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 7.53E-31 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 4.45E-20 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 1.45E-19 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 1.21E-22 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 1.31E-20 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 1.28E-22 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 6.00E-23 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 1.08E-21 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 8.24E-23 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 4.45E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 2.93E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 3.10E-06 NA mr1793_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 1.85E-14 mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220938287 NA 1.91E-17 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251