\
| Variant ID: vg1220919709 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20919709 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.56, C: 0.44, others allele: 0.00, population size: 43. )
TTTGAAAAAAACTCACCACTTTCAGCCCGGAAATAATAAAATAATACGTCCGGTGTCCTACAGCCAATTACATAATTTTTGTAGTGTCTATGGGCAGTGT[C/T]
ACGTTTTTGCGGTGTCTCTCAGCTAATTACATGATTTTTAAGTGTCTTATAGCAAATTTTTCCATAAAAATTTAATGAAGGATGAAGCAAGTTTGCTGCC
GGCAGCAAACTTGCTTCATCCTTCATTAAATTTTTATGGAAAAATTTGCTATAAGACACTTAAAAATCATGTAATTAGCTGAGAGACACCGCAAAAACGT[G/A]
ACACTGCCCATAGACACTACAAAAATTATGTAATTGGCTGTAGGACACCGGACGTATTATTTTATTATTTCCGGGCTGAAAGTGGTGAGTTTTTTTCAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.10% | 37.30% | 1.88% | 4.66% | NA |
| All Indica | 2759 | 46.40% | 53.40% | 0.18% | 0.11% | NA |
| All Japonica | 1512 | 80.40% | 2.60% | 4.10% | 12.90% | NA |
| Aus | 269 | 8.90% | 80.70% | 3.35% | 7.06% | NA |
| Indica I | 595 | 82.40% | 17.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 29.20% | 70.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 34.40% | 65.40% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 43.10% | 56.40% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 81.10% | 1.40% | 1.83% | 15.65% | NA |
| Tropical Japonica | 504 | 83.30% | 4.00% | 8.13% | 4.56% | NA |
| Japonica Intermediate | 241 | 71.80% | 3.70% | 2.90% | 21.58% | NA |
| VI/Aromatic | 96 | 74.00% | 14.60% | 11.46% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 24.40% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220919709 | C -> DEL | N | N | silent_mutation | Average:46.657; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| vg1220919709 | C -> T | LOC_Os12g34540.1 | upstream_gene_variant ; 463.0bp to feature; MODIFIER | silent_mutation | Average:46.657; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| vg1220919709 | C -> T | LOC_Os12g34540-LOC_Os12g34550 | intergenic_region ; MODIFIER | silent_mutation | Average:46.657; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220919709 | NA | 5.06E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220919709 | NA | 5.53E-07 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220919709 | NA | 8.38E-07 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220919709 | NA | 1.23E-09 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220919709 | NA | 5.09E-06 | mr1587 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220919709 | NA | 4.85E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220919709 | 1.43E-07 | 6.56E-10 | mr1803 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220919709 | NA | 9.49E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220919709 | NA | 7.59E-06 | mr1502_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |